Part:BBa_K3338003
P2A self-cleaving peptide without GSG-linker
Usage and Biology
The P2A peptide described here, is a self-cleaving peptide consisting of 18 aa that originates from the porcine teschovirus-1. It belongs to the group of 2A-peptides which is widely distributed among viruses. In viruses they are used to generate so called polyproteins in which the single proteins are interspaced with self-cleaving linkers (Luke et al. 2008). Although it is named a “self-cleaving” peptide the peptide bond between P and G on its C-terminal end is not cleaved after translation. It is rather believed that the ribosome fails to close the appropriate peptide bond but after that proceeds with translation (Sharma et al. 2012). In molecular biology it is used to generate polycistronic expression vectors (Szymczak-Workman et al. 2012).
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Characterization
To assess the expression efficiencies of the upstream and downstream localized coding region of the P2A peptide, we cloned P2A as a connector between EGFP and mCherry. Therefore, we amplified P2A and mCherry from the Addgene plasmid #45350 using primers with 20 bp overhangs suitable for NEBuilder® HiFi DNA Assembly cloning (for primers see table 1). The vector backbone was generated by linearizing the pEGFP-C2 vector with EcoRI and BamHI. The finished construct was sequentially verified. The vector map of the plasmid is shown in figure 1A.
| Primer name | Sequence |
|---|---|
| P2A_fw | CGAGCTGTACAAGTCCGGCCGGACTCAGATCTCGAGCTCAgctactaacttcagcctgctga |
| P2A_rv | tcctcgcccttgctcaccataggtccagggtt |
| mCherry_fw for P2A | tggaggagaaccctggacctatggtgagcaag |
| mCherry_rv for P2A | TGTGGTATGGCTGATTATGATCAGTTATCTAGATCCGGTGcttgtacagctcgtccatgcc |
Figure 1: Vector maps of EGFP-P2A-mCherry (A) and EGFP-IRES-mCherry (B) under control of the CMV-enhancer/promoter.
To assess the stoichiometry of simultaneous expression of both fluorescent proteins, transfection of HeLa cells with the plasmid was performed by lipofection (ViaFect transfection reagent) or electroporation and fluorescence microscopy was used for subsequent analysis. The fluorescence intensities of mCherry and EGFP can be used to assess the expression of both proteins and are roughly comparable among themselves. The results in figure 2 indicate comparable fluorescence intensities of EGFP and mCherry for P2A. Furthermore, all cells exhibiting EGFP-expression also show mCherry expression.
Besides P2A, IRES can also be used to form multicistronic vectors. Since the two elements offer completely different approaches for the simultaneous expression of proteins, we wanted to compare them with respect to the expression strength of the upstream and downstream protein. Because of that, an expression vector with IRES instead of P2A was generated (see figure 1B). For IRES large differences in the fluorescence intensities of the EGFP and the mCherry channel were detected. In fact, the expression of EGFP, whose translation is initiated by the standard process involving the 5’-cap, is much higher than the mCherry expression from the IRES. Additionally, many EGFP positive cells did not show an mCherry signal. It is of note that the absolute EGFP expression is higher in the IRES construct whereas the absolute expression of mCherry is higher in the P2A construct. This might be due to the fact that the bigger protein in the P2A construct is produced with a lower efficiency.
Summary
P2A facilitates high and comparable expression of both genes, making it applicable to form multicistronic vectors. In contrast the IRES allows only a weak translation of the second protein whereas the first (normally translated) protein exhibits higher expression levels compared to the P2A-Protein. Both behaviors might be beneficial for specific applications.
References
Luke, G. A., de Felipe, P., Lukashev, A., Kallioinen, S. E., Bruno, E. A., & Ryan, M. D. (2008). Occurrence, function and evolutionary origins of '2A-like' sequences in virus genomes. The Journal of general virology, 89(Pt 4), 1036–1042.
Sharma, P., Yan, F., Doronina, V. A., Escuin-Ordinas, H., Ryan, M. D., & Brown, J. D. (2012). 2A peptides provide distinct solutions to driving stop-carry on translational recoding. Nucleic acids research, 40(7), 3143–3151.
Szymczak-Workman, A. L., Vignali, K. M., & Vignali, D. A. (2012). Design and construction of 2A peptide-linked multicistronic vectors. Cold Spring Harbor protocols, 2012(2), 199–204.
| None |