Part:BBa_K3652006
Lentiviral Vector shRNA Regulatory Region (pLKO-tet-neo)
1. Usage
This part is a 3-section system including the human H1 promoter, tet-on operator system, and the encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES). It can be the regulatory precursor for any shRNA sequence inserted into a generation 3 lentiviral cloning (transfer) plasmid, such as the tet-pLKO-neo plasmid which we inserted this part into. The human H1 promoter is a Pol III promoter commonly used for RNAi applications--specifically, as the promoter for siRNA or shRNA coding sequences. It is slightly weaker than the additionally common promoter, U6, with typically lower expression levels and shorter-term effects when compared on similar genes and shRNA sequences [1]. We used it preceding our shRNA sequence, because we wanted to avoid irreversible gene knockdown, or very long-term effects in our target users, as it could lead to excess angiogenesis, and harm the patients. Ultimately H1 is a good choice for those looking for a weaker knockdown than that typically seen with U6 promoters.
The tet-on operator system is a very common regulatory system, developed in 1995 by Gossen et. al. It allows the activation of gene expression in the presence of tetracycline, or doxycycline via a variant of the TetR protein (developed by mutagenesis) [2]. This variant binds to tetO in the presence of tet/dox.
The EMCV IRES was used as the viral ribosome binding site. Though not strictly necessary for successful transcription of the following shRNA/siRNA sequence, it has been shown to increase efficacy of expression of the shRNA [3], so we included it seeking more successful transcription of the shRNA, at least during the testing. If it validates the transformation of our plasmid, and produces high amounts of shRNA, its removable can be considered to alter the potency of the shRNA production.
2. Source and Biology
The H1 promoter that we used comes from humans. It is also found in mice, but for the purpose of expressing an shRNA sequence meant to silence a human protein expression (the mRNA of sFlt1-14), we used the human variant. It works well in viral vectors intended to transfect human cells, particularly common in Adeno-associated virus (AAV) vectors, or lentiviral vectors, such as the tet-pLKO-neo transfer plasmid.
The tet-on is now a mainstream operator system used in synthetic biology, originating from the tetracycline resistance gene in E. coli. As explained in the Tet systems site, “TetR, the Tet repressor protein, inhibits transcription of the resistance protein in the absence of the antibiotic by binding to tetO sequences in the promoter region of the resistance gene. To facilitate specific binding, its cognate binding site tetO was multimerized and embedded into eukaryotic minimal promoters thus creating the Tet-inducible gene expression system” [4]. The double operator (Tet O1 and Tet O2) are used in the operating system, and in this composite part.
Finally, the EMCV IRES originates from the encephalomyocarditis virus, but is commonly used in various viral vectors, including adeno-viral vectors, adeno-associated viral vectors, and lentiviral vectors, as well several more obscure ones, for enhancing RNAi interference via the increased expression of interfering molecules, such as siRNA, dd-shRNA, ds-siRNA, shRNA, and others.
3. Design
The typical H1 promoter is around 300 nt long, and includes an illegal restriction site. As such, we had to look for alternative variations that were BioBrick compatible, and found that the H1 promoter used in the part BBa_K1150034 was a minimalistic variant that had eliminated the illegal EcoRI site present in the mainstream H1 promoter sequence, and had proof of functionality [5]. For the tet operator, we used the typical 19 nt sequence tccctatcagtgatagaga that was present in the tet-pLKO-neo plasmid backbone on addgene [6].
The tet-on operator was a good fit for us, because the tet-off system requires continual administration of tetracycline/doxycycline in order to repress the gene expression. We wanted an inducible system because it would be more effective and provide a safeguard for potential users of our shRNA treatment if they could induce its expression, and thus manage the expression of the overexpressed antiangiogenic molecule we were targeting, rather than perpetually degrading its mRNA, and administering tet/dox when wanting to cease knockdown. Ultimately, because the condition we are targeting is not permanent, an inducible system made more sense than a repressible one. These double operator sequences were linked by a short pseudo scar cttataagt.
For the EMCV IRES, we used a common and verified sequence that was provided within a lentiviral transfer plasmid that expressed a shRNA sequence [7]. These three parts were joined to form a moderately strong activator system to precede the shRNA sequences we wished to express via a lentiviral vector.
| Section | Sequence | Source |
| Human H1 Promoter | Cgcaattcgaacgctgacgtcatcaacccgctccaagga atcgcgggcccagtgtcactaggcgggaacacccagcgc |
adopted from part BBa_K1150034 |
| Tet operator | tccctatcagtgatagaga | Addgene [6] |
| EMCV IRES | gtataatagtagcacaaaaagtttccttttggtgcaggg gcaccaagccccccggatctgcaaaaaattggagctga |
Addgene [7] |
4. Application (Diagrams)
5. References
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 66
Illegal PstI site found at 274 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 274
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 66
Illegal PstI site found at 274 - 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 66
Illegal PstI site found at 274 - 1000COMPATIBLE WITH RFC[1000]
| None |