Part:BBa_K3697011
Toehold for Detection of KanR in B. subtilis
This DNA codes for a toehold switch to be produced in B. subtilis. This toehold switch will help assist in the detection of the DNA sequence GUCCUUUGCUCGGAAGAGUAUGAAGAUGAACAAAGC (a part of the KanR gene) once this sequence is brought into the cell by B. subtilis' natural competence system.
Usage and Biology
RNA toeholds riboregulators that are triggered by specific DNA or RNA sequences. Toeholds are comprised of a reverse compliment to the specified target sequence, a loop containing an RBS, the target sequence, a start codon, then a linker. When the target is not present, the reverse complement and target sequence section of the toehold form a hairpin, blocking ribosome binding to the RBS and access to the start codon. The linker connects the toehold to the RNA for the desired reporter protein. In the presence of the target, the reverse compliment in the toehold binds to the target nucleic acid through Watson-Crick base-pairing, breaking the hairpin. When the hairpin is broken, the RBS is exposed, leading to translation of the protein at the end of the linker.
Toeholds have been verified to work in E. coli, and have been used as detection methods in E. coli previously. This part is optimized for B. subtilis, which utilizes a different strong RBS optimized for B. subtilis. Additionally, the base pair length between the RBS and the start codon has been optimized for expression in B. subtilis.
The Stanford 2020 iGEM team designed this toehold as part of an in vivo detection system in B. subtilis. The toehold was engineered to regulate the expression of B. subtilis optimized YFP (BBa_K3697008). The toehold and reporter in this use case are under pVeg expression (BBa_K143012), the strongest known constitutive promotor in B. subtilis. After the reporter is a strong bacterial terminator, as B. subtilis produces extremely stable mRNAs. This was done through Gibson assembly with a PCR linearized pVeg YFP plasmid (BBa_K3697009). The toehold was ordered with 40bp homology to pVeg in front of the toehold, and 40bp homology to YFP behind the toehold for Gibson assembly.
In the presence of cells expressing or uptaking the KanR gene containing the target sequence, toehold binding should expose the RBS and lead to the translation of YFP at levels detectable by a plate reader.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
This sequence contains a toehold that targets a portion of the Bacillus subtilis KanR gene, GUCCUUUGCUCGGAAGAGUAUGAAGAUGAACAAAGC. It begins with the reverse complement of the target, a strong subtilis RBS, 11 basepairs of the target, and a linker.
| None |