Part:BBa_K3652001
sFlt1-14 shRNA (pLKO-tet-neo)
This DNA oligo is the cDNA template (5’ GTCATCATCATCATCATCATAAAGTTCTCTTATGATGATGATGATGATGAC 3’) for the shRNA designed to bind to and degrade sFlt1-14 mRNA in human endothelial cells. It can be inserted between any restriction site(s) with the proper prefix and suffix. When coded, this cDNA produces a shRNA sequence that will be manipulated by the Dicer enzyme in humans to produce siRNA and form a RISC complex that can degrade the mRNA of protein sFlt1-14, which is overproduced in the placentas of preeclamptic patients, and preventing its overexpression [1]. The target site on the sFlt1-14 mRNA is at position 2603-2626.
1. Usage
This shRNA sequence would be used to silence the expression of sFlt1-14 in the human placenta. It can be delivered in several different ways, including through a viral vector, transkingdom (E. coli/bacterial) deliver system, or via synthetic nanoparticles such as lipid packaging systems.
2. Biology
Eukaryotic organisms contain an RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA or shRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing two siRNAs, a sense strand, and an antisense strand. Each siRNA strand is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanisms can be triggered by introducing dsRNA, siRNA or shRNA, and sometimes miRNA as well.
3. Characterization
3.1 Design of GLS-shRNA-1
This part was synthesized as a shRNA (small hairpin RNA) sequence for the mRNA sequence of sFlt1-14 [2], a protein that plays a major role in the molecular mechanisms of preeclampsia [1]. sFlt1-14 (soluble Fms-like tyrosine kinase 1-14) is an antiangiogenic receptor that binds with PlGF (Placental Growth Factor) and VEGF (Vascular Endothelial Growth Factor), preventing them from binding to their proper receptors that signal for angiogenesis in the placenta. This shRNA cDNA can be expressed in any vector that is safe to use in vivo for human/mammalian RNAi (RNA interference).
The shRNA was developed as a region complementary to the mRNA of the sFlt1-14, and with several other parameters in mind, described below in design considerations.
This novel part was synthesized using siRNA design software, corroborated from several sources including the InvivoGen siRNA wizard [3], the Horizon Discovery siDESIGN tool [4], the GenScript siRNA Design Center [5], the Stanford Design Center [6], and the Thermo Fischer BLOCK-iT™ RNAi Designer software [7].
After cross-checking various siRNA recommended by the InvivoGen, Horizon, GenScript, Stanford Design, and Thermo Fisher software algorithms, the following general shRNA design guidelines from InvivoGen [8] were taken into consideration to attain this specific shRNA sequence:
Target site:
Not being in the first 100 bases from the start codon or within 100 bases from the stop codon
Not being in the intron
Nucleotide content of siRNA:
The first nucleotide of the siRNA coding sequence can either be an A or a G
(Generally A, but can be G if using an H1 promoter)
GC content of ~35-50% GC content
UU overhangs in 3′-end (increase siRNA stability)
siRNA should be < 30 nt to avoid nonspecific silencing
| shRNA | ALR-shRNA-1 |
| Sequence | 
|
| GC% of antisense strand | 52 |
| GC% at 5′-end of antisense strand | 48 |
| GC% at 3′-end of antisense strand | 56 |
| Target site | 231-251 after AUG |
3.2 In vitro transcription of GLS-shRNA-1
1) DNA Oligo Template Design
For primer 1, convert the sense strand of the siRNA sequence to the corresponding DNA sequence, add a 17 base T7 promoter sequence (TAATACGACTCACTATA) to the 5’end of the DNA sequence, add an 8 base loop sequence to the 3’-end of the DNA sequence. For primer 2, add the antisense sequence complementary to the loop sequence to the 3’-end of the DNA sequence. add 2 AA’s to the 5’-end of the Primer 2 oligo. DNA Oligos (Table 2) were ordered.
| Primers for DNA oligo template | Primers |
| GLS-shRNA-1 | P1: 5’ TAATACGACTCACTATAGGTCGGAGAAACCGATTGGGACTTGCTTC 3’ P2: 5’ AAGGTCGGAGAAACCGATTGGGAGAAGCAAG 3’ |
2) Fill-in reaction to generate GLS-shRNA-1 transcription templates
Each fill-in Reaction was set up with two Oligos
1.0 µl P1 Oligo (100 pmoles)
1.0 µl P2 Oligo (100 pmoles)
2.0 µl 10 x buffer 2 (NEB)
0.5 µl 50 X dNTPs (10 mM)
0.5 µl Klenow Fragment exo– DNA Polymerase (5 U/ ml)
15 µl RNase-Free Water
20 µl Total reaction volume, incubate the reaction mixtures for 2 hours at 37ºC, then 25 min at 75 ºC, cool at room temperature for 2 minutes.
The integrity of GLS-shRNA-1 templates was identified through 3% agarose gel eletrophoresis (Fig. 1). Agarose gel electrophoresis showed that the ALR-shRNA-1 template was successfully generated. Sharp bands can be seen on the gel, and the size of the bands is around 69 bases, which is the correct size.
3) In vitro transcription
1. in vitro transcription reaction was set up using the prepared template.
10.7 µl RNase-Free Water
2.0 µl Fill-In Reaction product
2.0 µl 10 x T7 RNA Polymerase Buffer (NEB)
2.8 µl 100mM MgSO4 (NEB)
1.0 µl NTP Mix (80 mM each NTP)
1.5 µl T7 RNA Polymerase (50 U/ µl)
20 ul Total reaction volume
2. Incubate the reaction mixtures for 2-3 hours at 37ºC.
3. Add 1 µl RNase-Free DNase I (1 Unit/ml) to remove the DNA template, 37ºC 15 min.
4. Heat the reaction mixtures for 15 minutes at 70ºC to inactivate the enzyme.
5. Extract with Phenol/Chloroform.
a. Add 100 µl RNase-Free Water to dilute the reaction.
b. Add 120 µl phenol/chloroform and vortex briefly to mix.
c. Spin in a microfuge for 1 minute at full speed.
d. Carefully pipette off the top aqueous phase and transfer to a clean tube.
6. Precipitate the shRNA.
a. To the recovered aqueous phase, add 1/10 vol. of 3 M Sodium Acetate (pH 5.2).
b. Add 2.5 volumes of 95-100% ethanol.
c. Incubate for 15 minutes on ice.
d. Pellet the shRNA in a microfuge by spinning at full speed for 15 minutes.
e. Remove the supernatant.
f. Carefully wash the pellet once with 70% ethanol.
g. Air dry the pellet for only 2-5 minutes.
7. Add 100 µl of the 1 X Annealing Buffer to the shRNA pellet and resuspend the shRNA.
The procedure of the shRNA in vitro transcription system is illustrated in Fig. 2.
The integrity of ALR-shRNA-1 was identified through 3% agarose gel eletrophoresis (Fig. 3) Agarose gel electrophoresis showed that the ALR-shRNA-1 was successfully transcribed. Sharp bands of around 52 bases in length were detected on the gel, the size of the bands is correct.
3.4 RNAi efficiency test
Adult P. striolata were obtained from Shenzhen University field station, and kept in glass bottles. The tissue culture seedlings of Chinese cabbage, Brassica chinensis leaves were placed into the above bottles (Fig. 4).
The solutions of GLS-shRNA-1 (10 ng/mL) was sprayed onto the leaves of Chinese cabbage every third day, each solution has two repeats. Around twenty adult beetles of P. striolata were tested per siRNA/shRNA sample. The survival rates of adult beetles, were recorded at different days after GLS-shRNA-1 treatment.
Results show that, GLS-shRNA-1 could trigger RNAi mechanism, which was demonstrated by the significant survival rate decrease after treatment, while the negative control sample showed slight survival rate decrease.
4. References
[1] Baum J.A., Bogaert T., Clinton W., Heck G.R., Feldmann P., Ilagen O., Johnson S., Plaetinck G., Munyikwa T., Pleau M., Vaughn T., Roberts J. 2007: Control of coleopteran insect pests through RNA interference. Nat. Biotech. 25: 1322–1326.
[2] Gorden K.H. & Waterhouse P.M. 2007: RNAi for insect-proof plants. Nat. Biotech.25: 1231–1232.
[3] Macrae I.J., Zhou K., Li F., Repic A., Brooks A.N., Cande W.Z., Adams P.D., Doudna J.A. 2006: Structural basis for double-stranded RNA processing by Dicer. Science. 311 (5758): 195–8.
[4] Mao Y.B., CAI W.J., WANG J.W., HONG G.J., TAO X.Y., WANG L.J., HUANG Y.P., CHEN X.Y. 2007: Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotech. 25: 1307–1313.
[5] Turner C.T., Davy M.W., Macdiarmid R.M., Plummer K.M., Birch N.P., Newcomb R.D. 2006: RNA interference in the light brown apple moth, Epiphyas postvittana (Walker) induced by double-stranded RNA feeding. Insect Mol. Biol. 15: 383–391.
[6] Wang M, Weiberg A, Lin F M, et al. Bidirectional cross-kingdom RNAi and fungal uptake of external RNAs confer plant protection[J]. Nature Plants, 2016, 2(10):16151-16151.
[7] Zhao Y.Y., Yang G., Pruski W., You M.S. 2008: Phyllotreta striolata (Coleoptera: Chrysomelidae): arginine kinase cloning and RNAi-based pest control. Eur J Entomol 105: 815–822.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
| None |