Collections/Best Basic Part

Revision as of 15:55, 16 July 2020 by Vinoo (Talk | contribs)

High-quality basic parts are essential to the Registry. Basic parts are a functional unit of DNA that (usually) cannot be subdivided into smaller component parts. The iGEM community can use these basic parts to create new devices that will be assembled and work predictably.

The following collection contains parts (and teams) that won, or were nominated, for the Best Basic Part award. Generally, these parts:

  • are novel and/or provide a useful function
  • are highly documented and characterized, with data and visualizations that show they work as expected
  • adhere to the iGEM competition's requirements and the Registry's requirements for submissions


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1582001sJanus from Trichoderma reeseiCodingDongqi Bao2281 . . . cttctgtgccagaccgccgtcggtgcttga
BBa_K1699001Human short TERT promoterRegulatoryEmil Ruvinov378  . . . ccctccccttcctttccgcggccccgccct
BBa_K1893013Small transcription activating RNA (STAR)RNAAkash Bhattacharjee1044 . . . caaagcccgccgaaaggcgggctttttttt
BBa_K2033000N-dodecanoyl-L-homoserine lactone (C(12)-HSL) Sender- AubISignallingBrady Dennison714  . . . aaattaggcctggtgggcgccgaggcctaa
BBa_K2201004Nucleotide Transporter PtNTT2 from Phaeodactylum tricornutumCodingChristopher M. Whitford17281 . . . atggaagcgaaaaccaacaaagaaaaataa
BBa_K2230022STM1128/pSB1C3CodingYi-Lun Huang & Pei-Hong Chen14971 . . . gaaaaacctgaaccaaaggtgacattatga
BBa_K2259000SynORI framework RNA II - Replication Initiator (Group A)ProjectLaurynas Karpus67014 . . . ttcttcctgttcctggtcttttgctcacat
BBa_K2668010Cerberus : A Molecular Binding Plateform (mSA2-CBM3a-AzF)CodingYounes Bouchiba1098  . . . accacgattcctccatcattggacgatccg
BBa_K2748000U24 protein from human herpesvirus 6ACodingXiaowen Mao264  . . . gttttccatgtgaatcgtcaaaggcgatga
BBa_K2753003pSB1C3-obGES cdsCodingWEI KUANGYI 17042 . . . tacgttgacgcgctgttctttacccaataa
BBa_K2818001Cas13d-NLS-ADARCodingDanny Teo Shun Xiang4143  . . . accgagcaggaccagttctcactcacgtaa
BBa_K3111011DARPin929CodingMatas Deveikis4773 . . . gaggtactccaaaaggccgcaaagctcaat
BBa_K3187028Sortase A7M (Ca2+-independent variant)CodingiGEM TU_Darmstadt 20194502 . . . atctttgtagctacagaagtcaaactcgag
BBa_K3264000NT-2Rep-CTCodingXinyou Chang1041  . . . caggatagcgtgggtcagtatgtgggctaa
BBa_K3352001Φ29 DNA Polymerase with His-Tag and GS linker SequenceCodingJoyce Ting1773-1 . . . ctagtggacgacacctttacgattaaataa
BBa_K3407004Fox-1 RBD: a protein domain binding strongly and specifically to RNA sequence UGCAUGU.CodingJavier Navarro Delgado363-1 . . . aagacggtgaacccgtacaccaatggctaa
BBa_K3484000Intein-mediated T3(THRB) → sfGFPProtein_DomainAndreu Pascuet & Eduard Sune2268-1 . . . atcgattacaaagatgacgacgacaaataa
BBa_K3730035Anti-hGPC3-scfv,a single chain variable antibody of human GPC3 protein. In our program, it is fused Protein_DomainLinhe Yang801-1 . . . ttcggtcagggtactaaactggagatcaag
BBa_K3758042Prrn16, rrn16 promoter (short version) Nicotiana tabacum RegulatoryMichael Burgis64-1 . . . gagggggcagggatggctatatttctggga
BBa_K4011003Fre-SttHCodingPeijia Lai2307-1 . . . tattttgcggcgatgggccagcgcgtgtaa
BBa_K4162005Hammerhead ribozymeRNAWeiwen Chen57-1 . . . actgaagagactggacgaaaccaataggtc
BBa_K4273000hSOD-linker-hCatalaseCodingXinyue Yao2094-1 . . . gcgaacctgcatcatcatcatcatcattaa
BBa_K4387000Nitric Oxide Sensing Promoter pNorVβRegulatoryJana Mehdy, Lea Bruellmann, Marine Mausy256-1 . . . caatctgcaattagcaagacatctttttag