Regulatory
Part:BBa_K3042002
Designed by: Rehmat Babar Group: iGEM19_Georgia_State (2019-10-11)
Promoter Region in Dino III Plasmid
This part was developed by the Senjie lab at University of Connecticut
- The promoter is a G rich, intergenic region, containing 672 base pairs, between O.Marina rhodopsin tandem repeats found in the DinoIII plasmid. It is incorporated in the DinoIII plasmid to increase the expression of arrO, which is a rifampin resistance gene. An increased expression of the rifampin resistance gene, as well as a higher cell survival rate, was observed.
- Because no proven promoter exists for dinoflagellates at this time, the “promoter region” was determined by locating the TTTT motif, which is 65 base pairs upstream from the start codon. This motif is present 133 base pairs upstream from the start codon in the DinoIII plasmid, and the value of these sequences cannot be evaluated (Sprecher, 2019).
- Primer Sets:
- GAGAACTAGTAAGTCCCGTGGCTGTCATATCTAG
- GACTCCTGGCCGAGATCTTCTAGAGGCTCCGAAATTTGGTCTA AGCAC
SymkaLHC5FN1 sequence information:
SymLHC3_5R sequence information:
Sprecher, Brittany & Zhang, Huan & Lin, Senjie. (2019). Nuclear gene transformation in a dinoflagellate. 10.1101/602821.
[edit]
Categories
Parameters
| None |