Regulatory
Part:BBa_K3007023:Design
Designed by: Cheng Li Group: iGEM19_QHFZ-China (2019-10-16)
CP6 promoter
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 32
Illegal XbaI site found at 135
Illegal PstI site found at 38 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 32
Illegal PstI site found at 38 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 32
Illegal BamHI site found at 43
Illegal BamHI site found at 118 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 32
Illegal XbaI site found at 135
Illegal PstI site found at 38 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 32
Illegal XbaI site found at 135
Illegal PstI site found at 38 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
When we used the part, the sequence at the 5' end of this part in the original vector (cctgatgcggtattttctccttacgcatctgtgcggtatttcact) was retained.
Source
E. coli