Part:BBa_K3037005
MBP+eGFP+dCas9
| MBP/eGFP/dCas9 | |
|---|---|
| Function | Reporter |
| Use in | Escherichia coli |
| RFC standard | Freiburg RFC25 standard |
| Backbone | pSB1C3 |
| Submitted by | Team: TU_Dresden 2019 |
Contents
Overview
This BioBrick was designed as a composite BioBrick by the team TU Dresden 2019. It is a fusion of dCas9 (BBa_K3037002) and eGFP (BBa_K3037006)(more information).
The dCas9 can bind to any sequence of DNA and eGFP is an enhanced reporter protein, giving emission at the wavelength of XX nm (reference)[1].
Additionally, the BioBrick is designed to have a N-terminal MBP fused to it (BBa_K3037001).This improves the solubility and expression and, therefore, the total cytoplasmic yield of the protein. The MBP can further be used to purify the fusion protein on an Amylose Resin and, afterwards, can be cleaved off via digestion with PreScission protease.
Characterization
Outline
We performed the following characterization experiments:
1) Prove of DNA-binding ability of dCas9 via Electrophoretic Mobility Shift Assay (EMSA)
2) Expression in BBa_K3037000, purification and tag-removal
3) Expression using pOCC97 (BBa_K3037000) in E. coli pRARE T7
Experiments in Detail
1) Prove of DNA-binding ability of dCas9 via an EMSA
1. Materials:
A. 100 ng of PCR amplified Sry gene
B. 200 ng of dCas9-GFP
C. 200 ng of guide RNA specifically targeting the amplified Sry gene
D. 1 x Reaction buffer - 20 mM Hepes buffer (pH 7.2)
100 mM Nacl
5 mM Mgcl2
0.1 mM EDTA
Six different guide RNAs were designed for targeting different regions of Sry gene. Using the online tool Benchling and FASTA sequence of Sry gene:
1: AACTAAACATAAGAAAGTGA
2: GAAAGCCACACACTCAAGAA
3: ACTGGACAACAGGTTGTACA
4: GTAGGACAATCGGGTAACAT
5: TTCGCTGCAGAGTACCGAAG
6: CCATGAACGCATTCATCGTG
2. Methods:
1. We wanted to check if the overall efficiency of mobility shift increases when combinations of guide RNAs are used, so individual reactions with combinations of guide RNA were used.
2. Guide RNA, dCas9-GFP and Sry gene were incubated in reaction buffer (respective amounts mentioned in the Materials section) at 37 °C for 1 hour.
3. Post incubation, they were mixed with loading dye without SDS, 20 % glycerol in Orange G dye and loaded onto 4-20 % gradient acrylamide - TBE precast gel. Gel was run for 3 hours at 75 V in 1x TBE buffer.
4. Gel was then stained using EtBR with 1:20000 dilution in 1x TBE for 10 minutes.
3.1 Results and Discussion of the 2 hours gel:
Lane 1 - There is a clear Sry gene at 800 base pairs and when Sry gene is incubated with only dCas9.
Lane 2 - There is no shift seen in the position of the gene.
Lane 3 - When guide RNA 1 was incubated with the dCas9 DNA reaction mix, we see a shift in the mobility, this is because of the protein DNA interaction and the binding is hindering the gene mobility.
Lanes 5,6,7,8 and 9 – Different combinations of guide RNAs were used. From Lanes 7 and 8 we see the highest mobility shift.
From the electromobility shift assay performed above we conclude that our expressed dCas9-GFP protein is functional and is able to successfully bind to gene with the help of appropriate guide RNAs.
3.2 Results and Discussion of the 3 hours gel:
This second gel was run more time in order to get rid of all the secondary structures of the RNA formed.
From Lane 3 to 7, no difference in the mobility of Sry gene can be seen when only guide RNA is added to the reaction mix.
In Lane 8, 9 and 10 a mobility shift of the gene can be appreciated and in Lane 11, when only guide RNA was loaded there is no bands.
In Lane 12, dCas9 is in stacking part of gel, owing to higher molecular weight.
4. Conclusions:
- We have a functional dCas9 expressed, which is able bind successfully to Sry gene with the help of guide RNA.
- dCas9 on its own is unable to bind to Sry gene, suggesting that for binding guide RNA is required.
- Guide RNA on their own is unable to cause mobility shift of Sry gene.
2) Expression in BBa_K3037000, purification and tag-removal
The protein was purified via Amylose resin column with the a N-terminal-MBP-tag BBa_K3037001.
The truncated versions than can be seen in the gel were taken away by ion exchange chromatography, so in the last lane we only have the complete transcript
1.) Purification step, proving that MBP-tag is working: lane 4 (MBP FT) and lane 5 (MBP elution)
2.)Removal of the MBP-tag by digestion with 3C protease, proving that preScission site is intact and recognized
3.) Purification by cation Exchange chromatography on HiTrap SP column, purifiying away the cleaved off tag
3) Expression using pOCC97 (BBa_K3037000) in E. coli pRARE T7
With this experiment we proved that is easy to express diferent and functional BioBricks with this vector
Sequence
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 3061
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 381
Illegal BamHI site found at 1930
Illegal BamHI site found at 5340 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 79
References
[1]
[2] https://www.genscript.com/bacterial-soluble-protein-expression-MBP-tag.html
| None |