Part:BBa_K2924005

guideRNA from long-chain-fatty-acid CoA ligase

long-chain-fatty-acid CoA ligase slr1609 guide RNA of Synechocystis sp.

Usage and Biology

Fig. 2: Reaction catalyzed by long-chain-fatty-acid CoA ligase

Fig. 3: Scheme of a knock-in as a consequence of homologous recombination in Synechocystis.

Fig. 4: Scheme of function of the CRISPRi/dCas9 - system. The dCas9 (yellow) binds with the sgRNA to the complementary DNA strand and inhibits the transcription by RNA polymerase II (blue).

This part contains the long-chain-fatty-acid CoA ligase guide RNA of Synechocystis sp. PCC 6803. It was used for an induced knock-down of slr1609 with a CRISPRi/dCas9-system, which was kindly provided by Yao et al. (2015)⁴. The long-chain-fatty-acid CoA ligase can be found under the UniProt ID: P73004_SYNY3¹ and is involved in fatty acid synthesis, degradation, and metabolism². The gene is positioned in the genome at 487287 - 489377 (2091 bp) bases ². The guide RNA was obtained by using the CRISPR guide from benchling³. The sgRNA in the gene is located at 201-220 bp in the + strand (Fig. 1). The sequence of the sgRNA is CCATTCCATCCATTGCCTGG, has anOn-Target Score of 72.2 and an Off-Target Score of 50.0.

The long-chain-fatty-acid CoA ligase catalyzes the pre-step reaction for β-oxidation of long-chain fatty acids by ligating coenzyme A to a fatty acid under consumption of a lot of energy in the form of ATP ⁵. These enzyme is present in all organisms from bacteria to human. Its mechanism is well known and can be divided in several steps.

Step one: One ATP molecule and a long-chain fatty acid enter the active site of the enzyme. The negatively charged oxygen of the fatty acid attacks the ATP and forms a AMP-fatty acid intermediate. Step two: Pyrophosphate leaves the active site. Step three: Coenzyme A enters the active site and forms with the AMP-fatty acid intermediate another one, the AMP-fatty acid-CoA. Step four: At the end, fatty acid-CoA and AMP are released out of the active site (Fig. 2)⁵.

This enzyme dimerizes and is then able to bind ATP at the C-terminal and fatty acid at the binding tunnel of the N-terminal, which can now interact with each other by different interaction between C- and N-terminal ⁵.

The short guide RNA (sgRNA) was cloned into a vector containing a neutral site of Synechocystis sp. PCC 6803. That’s a homologous sequence of its genome to ensure a knock-in into the genome (Fig. 3)⁴.

Due to this knock-in containing a resistance for antibiotic and the sgRNA, we can down-regulate the target enzyme with a CRISPRi/dCas9 - system ⁴. This system is induced by anhydrotetracycline (aTc), which activates the synthesis of the dCas9, which is then binding to the sgRNA. These complex is able to bind complementary to the targeted enzyme and stops the transcription of it (Fig. 4).

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Characterization

For testing the created system the cultures were induced with aTc and the growth rates were documented for few days. To check the transcriptional activity on the targeted gene, a qPCR was performed from pelletized cultures. Finally, the varying percentage yields of fatty acids were measured via gas chromatography-mass spectrometry.

Proof of concept

Fig. 5: Fluorescence measurement of the mVenus knock-down (KD) strain in the plate reader 24 h after induction with 500 nM aTc (red) or 100% EtOH (negative control, blue). 2 biological and 3 technical replicates were cultured in 6-well plates.

This concept has been tested with the fluorescent protein mVenus. The sgRNA was designed using the “CRISPR Guides” tool on benchling⁰ by choosing suitable candidate sgRNAs, which binds at the start of mVenus and cloned it via homologous recombination into the genome of Synechocystis sp. PCC 6803. Furthermore, this Synechocystis sp. PCC 6803 was transformed with a plasmid containing the P_cpc560 (BBa_K2924000) and the mVenus CDS (BBa_K2924035).

Synechocystis sp. WT and Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_P_cpc560_mVenus colonies were inoculated in BG11 medium with 20 µg/ml spectinomycin, 25 µg/ml kanamycin and 10 µg/ml chloramphenicol at 30°C and shaked with specific light and CO₂ conditions using 6 well plates. After 2 days of incubation, some cultures were induced with 500 nM aTc or with 100% EtOH as a control with the same amounts added. After 24 hours, the fluorescences were measured using a plate reader. Each sample was measured in biological duplicates, which are then tested in technically triplicates (Fig. 5).

As in Fig. 5 can be seen, the overall fluorescence decreased after induction with the inducer aTc. But in comparison to the empty vector control (EVC), fluorescence can be clearly measured. This proves our concept of down-regulating a protein or enzyme without abolishing the functions completely.

Ligase knock-down characterization

Fig. 6: Growth curve of <i>Synechocystis sp. PCC 6803 transformants after induction with 500 nM aTc over about 120 h.</i>

After inoculation and incubation of Synechocystis sp. PCC 6803 transformants with sgRNA_ligase (BBa_K2924005) in BG11, were diluted to an OD₇₅₀= 0.45, a few days later induced with an appropriate amount of 500 nM aTc while the following antibiotics were added: 20 µg/ml spectinomycin and 25 µg/ml kanamycin. The cultures were incubated at 30°C and shaken under light and specific CO₂ conditions.