Part:BBa_K2951004

Apt-influenzaA-NP

This part is a ssDNA aptamer that targets the nucleocapsid protein of influenza A virus (A/Michigan/297/2017(H1N1), sequence from NCBI(CY261696.1) gene:34-1530). The sequence of this part consists of primers (forward: ATAGGAGTCACGACGACCAGAA and reverse: TATGTGCGTCTACCTCTTGACTAAT) with the unique sequence of 40bp in between. The probe can be used for direct detection stratagies such as on-site influenza detection or aptamer-based biosensors. “Apt” is the abbreviation of aptamer and this probe is named “NPA-4” due to the target protein it should recognize and our label with number during experimental process.

Characterization

Titer value

 The titer value of this aptamer towards its target protein nucleocaspid is determined by practicing two types of ELISA. According to the coated protein, two important factors are tested:

AffinityNon-competitive ELISA by coating target protein Specificitycompetitive ELISA by coating un-target protein.

Non-competitive ELISA

Method

We set up different concentration of target protein(NPA) and non-target protein(NPB) via serial dilution and coat these protein each to a 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.

- NPB: this is the abbreviation for nucleoprotein of Influenza B virus (B/Colorado/16/2017) nucleoprotein and it act as a non-target protein in this ELISA experiment.

Result

Fig.1 (A)NPA-4 shows significant dose-dependent property. (B) We tested NPA-4 in specificity test have significant lower value comparing with the test of NPA protein. The results show that NPA-4 has the higher affinity toward NPA protein and lower affinity toward NPB which means higher specificity.

Competitive ELISA

Method

We set up different concentration of target protein(NPA) and non-target protein(NPB) via serial dilution and coat these protein each to a 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.

- NPB: this is the abbreviation for nucleoprotein of Influenza B virus (B/Colorado/16/2017) nucleoprotein and it act as a non-target protein in this ELISA experiment.

Result

Fig3A. The x axis represents the amount competitive protein added in the solution, and the y axis is the OD value measured. (A)When increasing the amount of competitive protein (target: influenza A nucleocapsid protein in affinity test), the OD value decrease shows that the free protein in the solution is capable of grabbing our aptamers. (B)When increasing the amount of competitive protein (non-target: influenza B protein in specificity test) there was no significant decrease in measured OD value, proving its specificity.