Coding
Part:BBa_K3021002:Design
Designed by: Jeremy Hu Group: iGEM19_PuiChing_Macau (2019-10-14)
NSP4-Laccase-HisTag
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 92
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 930
Illegal BglII site found at 1362
Illegal BamHI site found at 1739
Illegal XhoI site found at 962 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 145
Illegal NgoMIV site found at 1601
Illegal AgeI site found at 329 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 884
Illegal SapI.rc site found at 394
Design Notes
The original sequence from the paper is ATGAAAAAGATTACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCG with the Protein sequence is The n-region: MKKI(the positive net charge in the n-region: +2) The h-region: TAAAGLLLLA The c-region: AQPAMA; We have codon optimized this sequence.
Source
Laccase sequence is codon optimized from previous iGEM team, which was initiated based on Trametes versicolor; and the secretion peptide, NSP4, is sequence from E.coli based from a previous publication.
References
References: Han, S., Machhi, S., Berge, M., Xi, G., Linke, T., & Schoner, R. (2017). Novel signal peptides improve the secretion of recombinant Staphylococcus aureus Alpha toxinH35L in Escherichia coli. AMB Express, 7, 93.