Part:BBa_K2834003
Expressible apidaecin antimicrobial peptide from Apis mellifera
This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, apidaecin, a 6x His-Tag, and a T1 terminator from E. coli. This composite enables the expression of apidaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.
As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 2 and the His-tag. The exact synthesized sequence is:
CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTC
Usage and Biology
In the last few years, a lot of effort has been concentrated in the search of new alternative treatments against infections. Apidaecins are antimicrobial peptides isolated from lymph fluid of the adult honeybee that have come to address this necessity2. Structurally, these peptides are composed of 18 residues, containing 6 prolines (33%). This composition provides Apidaecin with a helical structure, antibacterial capacity, and high stability at acidic conditions. These properties have made Apidaecin a potential novel antibiotic drug1.
The mechanism of action of Apidaecin starts with the binding of the peptides to the outer membrane of bacteria. This binding is followed by the invasion of the periplasmic space, and by an irreversible combination with a receptor/docking molecule, component of a permease-type transporter system on inner membrane drug3. In our project, this mechanism of action suggested the use of Apidaecin as an alternative treatment against two diseases that affect Honeybee larvae, the American and European foulbrood.
Characterization of apidaecin atimicrobial peptide
This composite will be characterized with the intention of expressing abaecin in E. coli BL21 (DE3) by IPTG induction. Subsequently, its antimicrobial activity will be evaluated against Gram-positive bacteria with antibiotimicrobial susceptibility testing by measuring OD600 in broth.
BioBrick™ assembly
To achieve this goal, firstly, the composite was synthesized by IDT® with the prefix and suffix flanking the region of interest. The final part resulted in a sequence of 310 base pairs. Once the synthesis arrived, double digestion with EcoRI-HF and PstI restriction enzymes was made to the composite, and the chloramphenicol linearized plasmid backbone (pSB1C3) for following ligation of both fragments. This resulted in a complete expression plasmid of 2336 base pairs. Afterward, Escherichia coli BL21(DE3) was transformed by heat shock for following the antibiotic selection of clones. Next step consisted of plasmid extraction and electrophoresis gel of the uncut plasmid, linearized plasmid with one enzyme, and linearized plasmid with two enzymes. This agarose gel allowed the confirmation of the correct plasmid construction.
IPTG protein induction and extraction
Following the construction of the BioBrick, it was necessary to induce protein production. Since the T7 promoter regulates transcription of the construct, isopropyl β-D-1 thiogalactopyranoside (IPTG) is used as an inducer for T7 RNA polymerase production. The concentration of IPTG used was 0.5 mM. After induction, the cultures were incubated for six hours at 37 °C and 225 rpm. After that, protein extraction by lysis solution was made in order to obtain the soluble peptides. For insoluble peptides, the sample was treated with lysis solution + 6 M urea.
SDS-PAGE
After protein extraction, electrophoresis in a polyacrylamide gel (12%) was performed to corroborate the peptide of interest was indeed expressed. To calculate the molecular weight of the peptide, the Promega Biomath Calculator was used. The DNA length (bp) of the peptide was introduced, and Promega’s tool calculated the molecular weight in kDa. For apidaecin, a band at 2.75 kDa was expected.
In figure 2, a band at the approximate weight of 2.75 kDa can be seen; thus, it is inferred that the new BioBrick (BBa_K2834003) indeed expressed apidaecin.
Antibiotimicrobial susceptibility testing
In order to prove the antibacterial activity of apidaecin, antimicrobial susceptibility tests were performed for two different bacteria: Bacillus subtilis and Streptococcus pyogenes. B. subtilis was chosen because it is one of the best known Gram-positive microorganisms and S. pyogenes was chosen because it is one of the most important bacterial pathogens to humans. They both are widely known, commonly used, and thus allowed to better analyze the activity that the peptide has.
Being unable to isolate our peptides by affinity tag purification due to lack of equipment, crude protein extract was used in the experiment. In order to validate the experiment, different concentrations of the peptide and several controls were used; 12 ml of LB broth, with a bactericide agent or a control, were inoculated with 100μl of the overnight culture of each bacteria. Afterward, OD600 was measured at 3, 6, 9, and 21 hours after inoculation.
Antibiotimicrobial susceptibility test results
B. subtilis (figure 3a) was treated with 28.52 μg/mL (LC) and 142.6 μg/mL (HC) of total proteins of transformed E. coli BL21 (DE3) with apidaecin. Also, it was treated with 29.565 μg/mL (LC) and 147.825 μg/mL (HC) of untransformed E. coli BL21 (DE3) for negative control. A culture of B. subtilis was used as a negative control as well. At 21 h, both concentrations of apidaecin produced a decrease in OD600 compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with apidaecin OD600 decreases in 15.15% and with the highest one it decreases in 15.75%.
S. pyogenes (figure 3b) was treated with the same concentrations as B. subtilis. At 21 h, both concentrations of apidaecin produced a decrease in OD600 compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with apidaecin OD600 decreases in 10.2% and with the highest one it decreases in 12.45%.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 86
- 1000COMPATIBLE WITH RFC[1000]
References
1. Casteels, P., Ampe, C., Jacobs, F., Vaeck, M., & Tempst, P. (1989). Apidaecins: antibacterial peptides from honeybees. The EMBO Journal, 8(8), 2387–2391.
2. Mishra, A., Choi, J., Moon, E., & Baek, K.-H. (2018). Tryptophan-Rich and Proline-Rich Antimicrobial Peptides. Molecules, 23(4), 815. https://doi.org/10.3390/molecules23040815
3. Wei-Fenm L., Guo-Xia, M., & Xu-Xia, Z. (2006). Apidaecin-type peptides: Biodiversity, structure–function relationships and mode of action. National Institute for Biotechnology Information. DOI: 10.1016/j.peptides.2006.03.016
</p>
| None |