Part:BBa_K2621014

Toehold Switch 1 Trigger (CAT-Seq)

This part is a riboregulatory sequence - a Toehold switch. The sequence acts as an on/off switch to regulate the translation of the downstream gene. It is activated by a trigger RNA part [BBa_K2621014]. In the absence of RNA trigger transcript, toehold locks the translation of a downstream gene. By introducing trigger RNA transcript, the translation is free to initiate and produce the gene of interest.

The Toehold linker sequence has an additional T nucleotide at the 3’ end to stay in frame with the downstream gene as it starts the translation which propagates into downstream biobrick.

It is important to note, that it is advised to use this part with downstream coding sequences that have a prefix sequence 5' GAATTCGCGGCCGCTTCTAGAG '3 (used with non-coding sequences), as the standard prefix (and its scar) for protein coding genes contain a stop codon.

See how this part is used in the CAT-Seq by pressing here!

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Introduction

Biology

The Overview of the Toehold Riboregulators

Figure 1. Toehold switches repress translation through base pairs programmed before and after the start codon (AUG), leaving the RBS and start codon regions completely unpaired. The toehold domain a binds to a complementary a* domain on the trigger RNA ant initiates strand displacement which activates the translation Green, Alexander A. et al.

A toehold is a short RNA sequence that contains a ribosome binding site and a start codon followed by 9 amino acid linker. Importantly, it forms a stable secondary RNA hairpin structure that, in addition to locking the start codon in the stem loop, sequesters the ribosome binding site in a bulge loop.

As a consequence of stable secondary structure, the ribosome cannot bind and initiate the translation of a downstream gene. The linker codes for low-molecular-weight amino acids added to the N terminus of the gene of interest. This sequence increases the orthogonality of the toehold switches as it is important in forming the base of the stem loop and locks the start codon in it. The trigger RNA binds the 5’ end of the toehold and initiates strand displacement by linear-linear interaction.

As a result of that, the ribosome binding site and the start codon are accessible for ribosome binding and translation initiation. Since the trigger RNA binds the 5’ end of the toehold sequence, the nucleotide composition of it is an important factor that adds to the degree of different toehold systems cross interaction. By employing a specific linker sequence, the number of unique triggers with minimal cross interaction increases.

Usage with CAT-Seq (Catalytic Activity Sequencing)

About CAT-Seq

CAT-Seq stands for Catalytic Activity Sequencing - a system designed and built for high-speed activity and interaction characterization of Catalytic and Regulatory biological parts. You can learn more about CAT-Seq [http://2018.igem.org/Team:Vilnius-Lithuania-OG by clicking this link]

Catalytic Activity Sequencing Overview

Figure 1. Abstract scheme of the Catalytic Activity Sequencing method

1. Library preparation - A library of catalytic biomolecules is prepared.
2. Library encapsulation into droplets - Every library fragment is physically separated by encapsulating them into picoliter water droplets. Also, substrate nucleotides, the targets for catalytic biomolecules, are encapsulated.
3. Catalytic biomolecule production - In each droplet catalytic biomolecules are produced.
4. Catalysis of the substrate conversion - Catalytic biomolecules may recognise the Substrate Nucleotides as a target for chemical reaction catalysis. Depending on biomolecule activity, a specific number of nucleotides with removed substrates (product nucleotides) is established in each droplet.
5. Activity Recording
   1. Droplet Merging - each of prior droplet is merged with new droplet that contains DNA amplification mix and reference nucleotides. The reference nucleotides are helping to tracking the Product Nucleotide number.
   2. DNA amplification - DNA is amplified using the different unique catalytic biomolecule DNA in each droplet. During the amplification, the Product Nucleotides and the Reference Nucleotides are incorporated into the DNA sequence.
6. Activity Reading by Nanopore Sequencing - All of the droplets are broken and the amplified DNA is sequenced. During the sequencing, biomolecule’s activity is retrieved by calculating reference and Product Nucleotides (substrate removed), together with the sequence of particular biomolecule variant.

Genetic Regulatory Part activity and cross-interaction assessment

While Catalytic Activity Sequencing began as a method for catalytic biomolecule activity recording, we have also create a way to adjust CAT-Seq to record activities of regulatory part. In addition to the activities, cross-interactions of different regulatory parts can also be measured.

When assessing the activities and sequences of libraries of catalytic biomolecules in CAT-Seq , the activity is measured and recorded as a function of Product Nucleotide that was produced in each droplet.

Yet, the activity of the catalytic biomolecule is not the only aspect that can influence the amount of Product Nucleotides that are produced. If all of the droplets would contain the same catalytic biomolecule , but each droplet would have a different concentration of that biomolecule, we would in result get different amounts of Product Nucleotides. For example, droplets with large amount of biomolecules may produce a large number of Product Nucleotides and vice-versa. The default and well-characterized Catalytic Biomolecule in CAT-Seq for regulatory part charectation would be the CAT-Seq Esterase.

Figure 1. A scheme which illustrates the Product Nucleotide concentration on the Catalytic Biomolecule amount in droplets.

Yet, the activity of the catalytic biomolecule is not the only aspect that can influence the amount of Product Nucleotides that are produced. If all of the droplets would contain the same catalytic biomolecule , but each droplet would have a different concentration of that biomolecule, we would in result get different amounts of Product Nucleotides. For example, droplets with large amount of biomolecules may produce a large number of Product Nucleotides and vice-versa. The default and well-characterized Catalytic Biomolecule in CAT-Seq for regulatory part charectation would be the CAT-Seq Esterase.

Example for Toehold cross-interaction determination

Next, we want to give an example on how to record regulatory part interactions using CAT-Seq. In this case, we will be using Toehold Switches.

The Toehold Switch systems are composed of two RNA strands referred to as the Switch and Trigger. The Switch RNA contains the coding sequence of the gene being regulated. The Switch RNA forms a hairpin structure that includes the RBS site. While the hairpin structure is formed, the translation is inhibited. The Trigger RNA is a molecule that can selectively bind to the Switch RNA region and expose the gene RBS site for ribosomes. Once that happens, the protein translation can be initiated.

Once again, only the first part of general CAT-Seq design needs to be changed - the library preparation. Instead of using a catalytic biomolecule library, a single enzyme is used. Then, libraries need to be prepared - one for Toehold Switches and another for Trigger RNA. The Trigger RNA libraries also require a separate T7 promoter for RNA expression. Then, both of those libraries must be ligated to the enzyme DNA fragment. Resulting library contains fragments which have the same catalytic biomolecule (In the general case - the CAT-Seq Esterase), yet each of them have a random combination of a specific Toehold Switch and RNA Trigger.

Figure 1. Comparison between Standard CAT-Seq library constructs and Regulatory part adjusted CAT-Seq library constructs (For cross-interaction recording).

After the encapsulation, the droplets which have the correct Trigger RNA and Toehold Switch combination (in which Trigger RNA binds to that specific Toehold Switch), can produce catalytic biomolecules . In turn, those catalytic biomolecules can produce the Product Nucleotides.

In other droplets, where the Trigger RNA binds to the Toehold Switch with weaker affinity, there are also less catalytic biomolecules and Product Nucleotides produced. Finally, the droplets in which the Trigger RNA does not bind to the Toehold Switch, there are no biomolecules or product nucleotides produced.

Part Characterization (Vilnius-Lithuania Overgraduate 2018)

Cross-interaction measurements of Toehold Switches

The 9 library members, composed of 3 unique Toehold Switch sequences and 3 unique activating RNA sequences, termed Trigger RNA, were designed to test the orthogonality and regulatory characteristics of each part.

Each of the regulatory part, consisting of one toehold sequence upstream of the CAT-Seq esterase gene (BBa_K2621000) and one trigger sequence were constructed. First of all, the orthogonality of each toehold:activating RNA pair and they regulatory characteristic have been tested in bulk.

The constructed library members were synthesized using In vitro transcription and translation kit and their catalytic activity towards N4-benzoyl-2'-deoxycytidine triphosphate were tested. The reaction kinetics were measured using the spectrophotometer as a decrease of absorbance due tue hydrolyzed substrate nucleotide.

Figure 5. The catalytic activity of each Toehold:Trigger RNA construct matrix.CAT-Seq esterase mutant sequences were placed downstream the riboregulatory sequences with corresponding trigger part and they catalytic activity was measured. The decrease of absorbance corresponds to catalytically active enzyme. The graph shown as a matrix concludes that only Toehold sequences expressed with their corresponding Trigger RNA produce an active enzyme molecule.

Figure 5 displays the relative hydrolysis speed of each regulatory part variant in a form of matrix. The decrease of absorbance shown in Y axis corresponds to the catalytic conversion of substrate nucleotides. As seen from control experiment, in which standard esterase was expressed, the decline of absorbance over time is seen.

Taking these results into consideration, the same decrease of absorbance is only seen in the diagonal of the matrix. This means, that active catalytic molecules is expressed only when both regulatory molecules of the same group are present - Toehold1 (BBa_K2621011) with Trigger1 (BBa_K2621014), Toehold2 (BBa_K2621012) with Trigger2 (BBa_K2621015) and Toehold3 (BBa_K2621013) with Trigger3 (BBa_K2621016). None of the regulatory sequences show any cross talk with the other group. These results conclude the generation of working toehold riboswitches control library for regulatory sequences parameter and orthogonality screening.

Cross-interaction measurements of Toehold Switches using CAT-Seq

In addition to ribosome binding sites, we have constructed Toehold regulatory sequence library constituted of different toehold and triggers pairs was constructed subjected to catalytic activity sequencing method:

• BBa_K2621011 - Toehold Switch 1
• BBa_K2621012 - Toehold Switch 2
• BBa_K2621013 - Toehold Switch 3
• BBa_K2621014 - Trigger RNA 1
• BBa_K2621015 - Trigger RNA 2
• BBa_K2621016 - Trigger RNA 3

The mean methylation scores (reference nucleotide count) for each barcoded DNA template, housing different regulatory sequence were filtered and extracted from the DNA embedded with catalytic activity information (in a form of incorporated reference to catalytically converted nucleotide ratio).

Figure 23. The evaluation of Toehold-Trigger riboregulatory sequence orthogonality using CAT-Seq.The catalytic activity of esterase genes, regulated by different Toehold switches were measured using CAT-Seq. The mean methylation scores for each barcoded regulatory construct DNA template was filtered and essigned. Low methylation scores correspond to actively expressed protein and are only assigned when both Toehold and trigger sequences from the same group are present verifying the already measured orthogonality of regulatory parts.

The graph displays the mean methylation (reference nucleotide) scores assigned to each barcoded toehold-trigger construct read. Based on the results, low methylation score are only assigned when both Toehold and trigger sequences from the same group are present, due tue esterase being expressed. These results correlate perfectly to the standard (not in droplet) measurement results, carried out earlier.

Based on this fact it can be concluded that CAT-Seq activity sequencing method can be utilized as a precise and accurate way to screen and assign the activity and orthogonality of regulatory sequences.