Part:BBa_K2621011

Toehold Switch 1 (CAT-Seq)

This part is a riboregulatory sequence - a Toehold switch. The sequence acts as an on/off switch to regulate the translation of the downstream gene. It is activated by a trigger RNA part:BBa_K2259016. In the absence of RNA trigger transcript, toehold locks the translation of a downstream gene. By introducing trigger RNA transcript, the translation is free to initiate and produce the gene of interest.

The Toehold linker sequence has an additional T nucleotide at the 3’ end to stay in frame with the downstream gene as it starts the translation which propagates into downstream biobrick.

It is important to note, that it is advised to use this part with downstream coding sequences that have a prefix sequence 5' GAATTCGCGGCCGCTTCTAGAG '3 (used with non-coding sequences), as the standard prefix (and its scar) for protein coding genes contain a stop codon.

See how this part is used in the CAT-Seq by pressing here!

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Introduction

Biology

The Overview of the Toehold Riboregulators

Figure 1. Toehold switches repress translation through base pairs programmed before and after the start codon (AUG), leaving the RBS and start codon regions completely unpaired. The toehold domain a binds to a complementary a* domain on the trigger RNA ant initiates strand displacement which activates the translation Green, Alexander A. et al.

A toehold is a short RNA sequence that contains a ribosome binding site and a start codon followed by 9 amino acid linker. Importantly, it forms a stable secondary RNA hairpin structure that, in addition to locking the start codon in the stem loop, sequesters the ribosome binding site in a bulge loop.

As a consequence of stable secondary structure, the ribosome cannot bind and initiate the translation of a downstream gene. The linker codes for low-molecular-weight amino acids added to the N terminus of the gene of interest. This sequence increases the orthogonality of the toehold switches as it is important in forming the base of the stem loop and locks the start codon in it. The trigger RNA binds the 5’ end of the toehold and initiates strand displacement by linear-linear interaction.

As a result of that, the ribosome binding site and the start codon are accessible for ribosome binding and translation initiation. Since the trigger RNA binds the 5’ end of the toehold sequence, the nucleotide composition of it is an important factor that adds to the degree of different toehold systems cross interaction. By employing a specific linker sequence, the number of unique triggers with minimal cross interaction increases.

Usage with CAT-Seq (Catalytic Activity Sequencing)

About CAT-Seq

CAT-Seq stands for Catalytic Activity Sequencing - a system designed and built for high-speed activity and interaction characterization of Catalytic and Regulatory biological parts. You can learn more about CAT-Seq [http://2018.igem.org/Team:Vilnius-Lithuania-OG by clicking this link]

Catalytic Activity Sequencing Overview

Figure 1. Abstract scheme of the Catalytic Activity Sequencing method

1. Library preparation - A library of catalytic biomolecules is prepared.
2. Library encapsulation into droplets - Every library fragment is physically separated by encapsulating them into picoliter water droplets. Also, substrate nucleotides, the targets for catalytic biomolecules, are encapsulated.
3. Catalytic biomolecule production - In each droplet catalytic biomolecules are produced.
4. Catalysis of the substrate conversion - Catalytic biomolecules may recognise the Substrate Nucleotides as a target for chemical reaction catalysis. Depending on biomolecule activity, a specific number of nucleotides with removed substrates (product nucleotides) is established in each droplet.
5. Activity Recording
   1. Droplet Merging - each of prior droplet is merged with new droplet that contains DNA amplification mix and reference nucleotides. The reference nucleotides are helping to tracking the Product Nucleotide number.
   2. DNA amplification - DNA is amplified using the different unique catalytic biomolecule DNA in each droplet. During the amplification, the Product Nucleotides and the Reference Nucleotides are incorporated into the DNA sequence.
6. Activity Reading by Nanopore Sequencing - All of the droplets are broken and the amplified DNA is sequenced. During the sequencing, biomolecule’s activity is retrieved by calculating reference and Product Nucleotides (substrate removed), together with the sequence of particular biomolecule variant.