Part:BBa_K2621011

Toehold Switch 1 (CAT-Seq)

This part is a riboregulatory sequence - a Toehold switch. The sequence acts as an on/off switch to regulate the translation of the downstream gene. It is activated by a trigger RNA part:BBa_K2259016. In the absence of RNA trigger transcript, toehold locks the translation of a downstream gene. By introducing trigger RNA transcript, the translation is free to initiate and produce the gene of interest.

The Toehold linker sequence has an additional T nucleotide at the 3’ end to stay in frame with the downstream gene as it starts the translation which propagates into downstream biobrick.

It is important to note, that it is advised to use this part with downstream coding sequences that have a prefix sequence 5' GAATTCGCGGCCGCTTCTAGAG '3 (used with non-coding sequences), as the standard prefix (and its scar) for protein coding genes contain a stop codon.

See how this part is used in the CAT-Seq by pressing here!

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Introduction

Biology

The Overview of the Toehold Riboregulators

Figure 1. Toehold switches repress translation through base pairs programmed before and after the start codon (AUG), leaving the RBS and start codon regions completely unpaired. The toehold domain a binds to a complementary a* domain on the trigger RNA ant initiates strand displacement which activates the translation Green, Alexander A. et al.

A toehold is a short RNA sequence that contains a ribosome binding site and a start codon followed by 9 amino acid linker. Importantly, it forms a stable secondary RNA hairpin structure that, in addition to locking the start codon in the stem loop, sequesters the ribosome binding site in a bulge loop.

As a consequence of stable secondary structure, the ribosome cannot bind and initiate the translation of a downstream gene. The linker codes for low-molecular-weight amino acids added to the N terminus of the gene of interest. This sequence increases the orthogonality of the toehold switches as it is important in forming the base of the stem loop and locks the start codon in it. The trigger RNA binds the 5’ end of the toehold and initiates strand displacement by linear-linear interaction.

As a result of that, the ribosome binding site and the start codon are accessible for ribosome binding and translation initiation. Since the trigger RNA binds the 5’ end of the toehold sequence, the nucleotide composition of it is an important factor that adds to the degree of different toehold systems cross interaction. By employing a specific linker sequence, the number of unique triggers with minimal cross interaction increases.

Usage with CAT-Seq (Catalytic Activity Sequencing)

About CAT-Seq

CAT-Seq stands for Catalytic Activity Sequencing - a system designed and built for high-speed activity and interaction characterization of Catalytic and Regulatory biological parts. You can learn more about CAT-Seq [http://2018.igem.org/Team:Vilnius-Lithuania-OG by clicking this link]

Catalytic Activity Sequencing Overview

Figure 1. Abstract scheme of the Catalytic Activity Sequencing method

1. Library preparation - A library of catalytic biomolecules is prepared.
2. Library encapsulation into droplets - Every library fragment is physically separated by encapsulating them into picoliter water droplets. Also, substrate nucleotides, the targets for catalytic biomolecules, are encapsulated.
3. Catalytic biomolecule production - In each droplet catalytic biomolecules are produced.
4. Catalysis of the substrate conversion - Catalytic biomolecules may recognise the Substrate Nucleotides as a target for chemical reaction catalysis. Depending on biomolecule activity, a specific number of nucleotides with removed substrates (product nucleotides) is established in each droplet.
5. Activity Recording
   1. Droplet Merging - each of prior droplet is merged with new droplet that contains DNA amplification mix and reference nucleotides. The reference nucleotides are helping to tracking the Product Nucleotide number.
   2. DNA amplification - DNA is amplified using the different unique catalytic biomolecule DNA in each droplet. During the amplification, the Product Nucleotides and the Reference Nucleotides are incorporated into the DNA sequence.
6. Activity Reading by Nanopore Sequencing - All of the droplets are broken and the amplified DNA is sequenced. During the sequencing, biomolecule’s activity is retrieved by calculating reference and Product Nucleotides (substrate removed), together with the sequence of particular biomolecule variant.

Determining the accuracy of CAT-Seq

Trying to build a CAT-Seq pipeline in your own laboratory will require the CAT-Seq esterase in order to troubleshoot the system and assess the measurement accuracy and precision. In other words, the esterase and its mutants can be used to calibrate the CAT-Seq.

Together with the Esterase, its substrate attached to a nucleotide is required (substrate nucleotide). In the standard case, the Substrate Nucleotide is N4-benzoyl-2'-deoxycytidine triphosphate. If the Esterase catalyzes the removal of the substrate from the nucleotide, it becomes the Product Nucleotide - 2'-deoxycytidine triphosphate.

Part Characterization (Vilnius-Lithuania Overgraduate 2018)

Kinetic characterization of the original CAT-Seq Esterase

Spectrofotometic kinetic data based on decay of absorbance at 310 nm due to substrate nucleotide catalytic conversion was gathered using a range of starting substrate nucleotide concentrations. A Michelis Menten curve for the CAT-Seq esterase was plotted using the aquired data. Data shown in 1 Fig., show perfect fit (R2 = 0.9449) to a standard Michaelis Menten curve.

Figure 1. Michaelis Menten Curve generated for CAT-Seq Esterase enzyme. The initial velocity of the enzyme was determined spectrophotometrically as a decay of absorbance at 310 nm at different starting substrate nucleotide concentrations. The graph shows the average values of three independent experiments.

Michaelis Menten plot transformations were generated for CAT-Seq esterase enzyme (BBa_K2621000). 2 Fig., display Lineweaver-Burk and Hanes-Woolf transformation plot. Based on the equation koeficients in the Hanes-Woolf transformation, the expermentally determined Vmax value is 17.2 µM/min, Km value is 86 µM.

Figure 1. Two Michaelis Menten Curve transformations for CAT-Seq Esterase enzyme. Lineweaver-Burk and Hanes-Woolf transformations for Michaelis Menten curve generated earlier. Both of the transformations were performed on data acquired from 3 independent experiments. Graphs show the fitted linear function and its correlation coefficient.

Esterase and its mutants catalytic activity determination

The 10 esterase mutants housing mutations at bioinformatically predicted sites were created. To see why and how mutations were designed in-silico, [http://2018.igem.org/Team:Vilnius-Lithuania-OG/Model please click this link]. Each of the mutant was constructed utilizing PCR and synthesized using In vitro transcription and translation kit and their catalytic activity towards N4-benzoyl-2'-deoxycytidine triphosphate were tested.

Figure 3. Relative activity of In silico generated CAT-Seq esterase mutants CAT-Seq esterase mutant sequences were generated In silico and synthesised using in vitro transcription and translation kit. The graph shows the relative catalytic activity of each generated mutant measured spectrophotometrically and the corresponding mutation site.The activity was normalized to wild type (WT) enzyme.

The reaction kinetics were measured using the spectrophotometer as a decrease of absorbance. Figure 3 displays the relative hydrolysis speed of each mutant generated. As seen from these results, a variety of mutants, showing different catalysis speeds were produced. Some of the amino acids changes affected the activity drastically, for example Trp224 to Tyr, Lys227 to Arg or Glu509 to Lys. Other mutations only modulated the activity Asn107 to Asp or Glu194 to Ala. Additionally, large 8 amino acid deletion at position Pro348-Hy356 caused only a moderate decrease in enzymes activity.

Esterase and mutants activity assessment using CAT-Seq

The constructed in silico designed mutant library was subjected to catalytic activity sequencing. By applying the data preparation and analysis pipeline, the mean methylation scores arising from different ratios of catalytically converted and reference nucleotides for each barcoded mutant DNA template were filtered and extracted from the DNA embedded with catalytic activity information (in a form of incorporated reference to catalytically converted nucleotide ratio). The collected data was normalized over Wild Type Esterase and K227R mutant (lowest activity).

Figure 1. Comparison of In bulk and CAT-Seq measured esterase mutant relative activity. In silico generated Esterase mutant library was subjected to catalytic activity sequencing. The mean methylation scores for each barcoded mutant DNA template were filtered and extracted. The collected data was normalized over Wild Type CAT seq Esterase and K227R mutant (lowest activity). The relative activity, extracted from the mean methylation score of each mutant read is compared to measurement data gathered in standard sized reactions (in bulk) .

The relative methylation score (reference nucleotide count) of each mutant read corresponds to the activity of the enzyme it encodes. The higher the activity of the expressed enzyme, the lower methylation score are assigned, due to catalytic conversion of substrate nucleotides. The comparison of the results, gathered with CAT-Seq catalytic activity sequencing method and in standard sized reactions (in bulk) spectrophotometric data (Fig 1.) conclude the viability of CAT-Seq approach. The activity reading, extracted from the DNA sequence correlates with the in bulk measurement data perfectly. The activity of the each Esterase mutant is measured accurately and is assigned to the corresponding DNA sequence.