Part:BBa_K2834005
Expressible defensin 1 antimicrobial peptide from Apis mellifera
This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, defensin 1 honey bee antimicrobial peptide, a 6x His-tag, and a T1 terminator from E. coli. This composite enables the expression of defensin 1 in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.
As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 1 and the His-tag. The exact synthesized sequence is:
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCAT
GGTAACTTGTGACCTTCTCTCATTCAAAGGACAAGTTAATGACAGTGCTTGCGCTGCTAACTGTCTCAGTTTGGGTAAAGCTGGAGGTCATTGCGAGAAAGGAGTTT
GTATTTGTCGAAAAACCAGTTTCAAAGATCTCTGGGACAAACGTTTCGGTCATCACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAG TCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC
Usage and Biology
Defensin 1 is an antimicrobial peptide of the honeybee. It's a component of their innate immune response, which contains 51 amino acids and 6 cysteine residues forming three disulfide bonds2. It is synthesized in salivary glands and characterizes the social immunity. Sometimes is able to protect honeybees even in early stages and act as part of individual immunity4. This AMP is expressed in the head and thorax of honey bees by the hypopharyngeal, mandibular and thoracic salivary glands3. It is present in the royal jelly, honey and hemolymph. Originally, it was isolated from royal jelly, and therefore named royalisin2.
This peptide is effective against Gram-positive bacteria and some species of Gram-negative bacteria like Pseudomonas aeruginosa and Salmonella choleraesuis1. The mechanism of the defensin effect is reduced to disturbance of integrity and permeability of the cytoplasmic membrane. Defensin 1 is used in our project against Paenibllus larvae and Melissococcus plutonius, this would control the immunity level of a honey bee colony and reduce the using of antibiotics.
Characterization of defensin 1 antimicrobial peptide
This composite will be characterized with the intention of expressing defensin 1 in E. coli BL21 (DE3) by IPTG induction. Subsequently, its antimicrobial activity will be evaluated against Gram-positive bacteria with antibiotic susceptibility testing by measuring OD600 in broth.
BioBrick assembly
To achieve this goal, firstly, the composite was synthesized by IDT® with the prefix and suffix flanking the region of interest. The final part resulted in a sequence of 415 base pairs. Once the synthesis arrived, double digestion with EcoRI-HF and PstI restriction enzymes was made to the composite, and the chloramphenicol linearized plasmid backbone (pSB1C3) for following ligation of both fragments. This resulted in a complete expression plasmid of 2442 base pairs. Afterward, Escherichia coli BL21(DE3) was transformed by heat shock for following the antibiotic selection of clones. Next step consisted of plasmid extraction and electrophoresis gel of the uncut plasmid, the linearized plasmid with one enzyme, and the linearized plasmid with two enzymes. This agarose gel allowed the confirmation of the correct plasmid construction.
IPTG protein induction and extraction
Following the construction of the BioBrick, it was necessary to induce protein production. Since the T7 promoter regulates transcription of the construct, isopropyl β-D-1 thiogalactopyranoside (IPTG) is used as an inducer for T7 RNA polymerase production. The concentration of IPTG used was 0.5 mM. After induction, the cultures were incubated for six hours at 37 °C and 225 rpm. After that, protein extraction by lysis solution was made in order to obtain the soluble peptides. For insoluble peptides, the sample was treated with lysis solution+6M urea.
SDS-PAGE
After protein extraction, electrophoresis in a polyacrylamide gel (12%) was performed to corroborate the peptide of interest was indeed expressed. To calculate the molecular weight of the peptide, the Promega Biomath Calculator was used. For defensin 1, a band at 5.94 kDa was expected.
In figure 2, a band at the approximate weight of 5.94 kDa can be seen; thus, it is inferred that the new BioBrick (BBa_K2834005) indeed expressed defensin 1.
Antimicrobial susceptibility testing
In order to prove the antibacterial activity of defensin 1, antimicrobial susceptibility tests were performed for two different bacteria: Bacillus subtilis and Streptococcus pyogenes. B. subtilis was chosen because it is one of the best known Gram-positive microorganisms and S. pyogenes was chosen because it is one of the most important bacterial pathogens to humans. They both are widely known, commonly used, and thus allowed to better analyze the activity that the peptide has.
Being unable to isolate our peptides by affinity tag purification due to lack of equipment, crude protein extract was used in the experiment. In order to validate the experiment, different concentrations of the peptide and several controls were used; 15 ml of LB broth, with a bactericide agent or a control, were inoculated with 100μl of the overnight culture of each bacteria. Afterward, OD600 was measured at 3, 6, 9, and 21 hours after inoculation.
Antibiotic susceptibility test results
B. subtilis (figure 3a) was treated with 30.6 μg/mL (LC) and 153 μg/mL (HC) of total proteins of transformed E. coli BL21 (DE3) with defensin 1. Also, it was treated with 29.565 μg/mL (LC) and 147.825 μg/mL (HC) of untransformed E. coli BL21 (DE3) for negative control. A culture of B. subtilis was used as a negative control as well. At 21 h, both concentrations of defensin 1 produced a decrease in OD600 compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with defensin 1 OD600 decreases in 14.23% and with the highest one it decreases in 16.28%.
S. pyogenes (figure 3b) was treated with the same concentrations as B. subtilis. At 21 h, both concentrations of defensin 1 produced a decrease in OD600 compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with defensin 1 OD600 decreases in 8.26% and with the highest one it decreases in 12.99%.
</center>
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 233
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 86
- 1000COMPATIBLE WITH RFC[1000]
<b>
References
1. Bucekova, M., Sojka, M., Valachova, I., Martinotti, S., Ranzato, E., Szep, Z., Majtan, V., Klaudiny, J., & Majtan, J. (2017). Bee-derived antibacterial peptide, defensin-1, promotes wound re-epithelialisation in vitro and in vivo. Scientific reports, 7(1), 7340.
2. Danihlík, J., Aronstein, K., & Petřivalský, M. (2015). Antimicrobial peptides: a key component of honey bee innate immunity. Journal of Apicultural Research, 54(2), 123–136. doi:10.1080/00218839.2015.1109919
3. Ilyasov, R., Gaifullina, L., Saltykova, E., Poskryakov, A., & Nikolenko, A. (2012). Review of the Expression of Antimicrobial Peptide Defensin in Honey Bees Apis Mellifera L., Journal of Apicultural Science, 56(1), 115-124. doi.org/10.2478/v10289-012-0013-y
4. Tesovnik, T., Cizelj, I., Zorc, M., Čitar, M., Božič, J., Glavan, G., & Narat, M. (2017). Immune related gene expression in worker honey bee (Apis mellifera carnica) pupae exposed to neonicotinoid thiamethoxam and Varroa mites (Varroa destructor). PloS one, 12(10), e0187079.
None |