Part:BBa_K2834005

Expressible defensin 1 antimicrobial peptide from Apis mellifera

This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, defensin 1 honey bee antimicrobial peptide, a 6x His-tag, and a T1 terminator from E. coli. This composite enables the expression of defensin 1 in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.

As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 1 and the His-tag. The exact synthesized sequence is:
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCAT GGTAACTTGTGACCTTCTCTCATTCAAAGGACAAGTTAATGACAGTGCTTGCGCTGCTAACTGTCTCAGTTTGGGTAAAGCTGGAGGTCATTGCGAGAAAGGAGTTT GTATTTGTCGAAAAACCAGTTTCAAAGATCTCTGGGACAAACGTTTCGGTCATCACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAG TCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC

Usage and Biology

Defensin 1 is an antimicrobial peptide of the honeybee. It's a component of their innate immune response, which contains 51 amino acids and 6 cysteine residues forming three disulfide bonds². It is synthesized in salivary glands and characterizes the social immunity. Sometimes is able to protect honeybees even in early stages and act as part of individual immunity⁴. This AMP is expressed in the head and thorax of honey bees by the hypopharyngeal, mandibular and thoracic salivary glands³. It is present in the royal jelly, honey and hemolymph. Originally, it was isolated from royal jelly, and therefore named royalisin².

This peptide is effective against Gram-positive bacteria and some species of Gram-negative bacteria like Pseudomonas aeruginosa and Salmonella choleraesuis¹. The mechanism of the defensin effect is reduced to disturbance of integrity and permeability of the cytoplasmic membrane. Defensin 1 is used in our project against Paenibllus larvae and Melissococcus plutonius, this would control the immunity level of a honey bee colony and reduce the using of antibiotics.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal BglII site found at 233
  
• 23
  COMPATIBLE WITH RFC[23]
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal NgoMIV site found at 86
  
• 1000
  COMPATIBLE WITH RFC[1000]

References

1. Bucekova, M., Sojka, M., Valachova, I., Martinotti, S., Ranzato, E., Szep, Z., Majtan, V., Klaudiny, J., & Majtan, J. (2017). Bee-derived antibacterial peptide, defensin-1, promotes wound re-epithelialisation in vitro and in vivo. Scientific reports, 7(1), 7340.

2. Danihlík, J., Aronstein, K., & Petřivalský, M. (2015). Antimicrobial peptides: a key component of honey bee innate immunity. Journal of Apicultural Research, 54(2), 123–136. doi:10.1080/00218839.2015.1109919

3. Ilyasov, R., Gaifullina, L., Saltykova, E., Poskryakov, A., & Nikolenko, A. (2012). Review of the Expression of Antimicrobial Peptide Defensin in Honey Bees Apis Mellifera L., Journal of Apicultural Science, 56(1), 115-124. doi.org/10.2478/v10289-012-0013-y

4. Tesovnik, T., Cizelj, I., Zorc, M., Čitar, M., Božič, J., Glavan, G., & Narat, M. (2017). Immune related gene expression in worker honey bee (Apis mellifera carnica) pupae exposed to neonicotinoid thiamethoxam and Varroa mites (Varroa destructor). PloS one, 12(10), e0187079.