Part:BBa_K2571001
Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase
Usage and Biology
Glutathione (GSH) is an important antioxidant that is a sulfur compound; a tripeptide composed of three amino acids (cysteine, glycine and glutamic acid) and a non-protein thiol (Pizzorno, 2014; Lu, 2013). Similar to cysteine, glutathione contains the crucial thiol (-SH) group which benefits to its efficiency as an antioxidant (“Glutathione”, 2005). As a substrate for glutathione S-transferase, which reacts with a number of harmful chemical species, such as halides, epoxides, and free radicals to form harmless products (“Glutathione”, 2005). GSH is generally found in the thiol-reduced from which is crucial for detoxification of ROS and free radicals which cause oxidative stress. (Lu, 2013; Burton & Jauniaux, 2011).
Figure represents the predicted three-dimensional structure Bifunctional gamma-glutamate-cysteine ligase from Streptococcus Thermophilus . The protein structure of Bifunctional gamma-glutamate-cysteine ligase was constructed by using Amber 14. It is demonstrated in the ribbon diagram which is done by interpolating a smooth curve through the polypeptide backbone. The colors indicate the amino acids in the protein structure. While constructing, the codon bias rule is obeyed to express the enzyme in Escherichia Coli KO11.
During bioethanol production, furfural, HMF and reactive oxygen species (ROS) occur which are converted to less toxic alcohols by oxidoreductases (Ask et al, 2013). Reactive Oxygen Species are dangerous substances that distort protein based matters by taking electrons (Lu, 2013). The chemical structure of the protein-based substances are altered and become dysfunctional because of ROS (Lu, 2013; Burton & Jauniaux, 2011). Furthermore, one of the most significant protein-based substance, DNA get attacked by OH radicals (Burton & Jauniaux, 2011). These attacks cause severe damages to the DNA such as cross-linkages, chromatin folding and strand breakages (Burton & Jauniaux, 2011). However, the reduced form GSH can protect the chemical structure of the proteins by giving extra electrons to the ROS and free radicals (Lu, 2013). This is accomplished by GSH peroxidase-catalyzed reactions (Lu, 2013). When GSH give away its electron, it oxidizes to GSSG (disulfide-oxidized Glutathione ). Then, GSSG is reduced to GSH at the expense of NADPH by Glutathione reductase.
However, the detoxification of ROS and conversion of furfural and HMF result in a more oxidized intracellular environment that deteriorates the antioxidant defense system of the cell (Ask et al., 2013).
Gel Characterization
GSH basic part is inserted into the pSB1C3 backbone. The construct in pSB1C3 is for submission to the registry and is cultivated in DH5 alpha.
FucO and VR primers are as below:
FucO left: GTGATAAGGATGCCGGAGAA
VR: ATTACCGCCTTTGAGTGAGC
Allergen Characterization:
Our parts can be used in ethanol production and we used it in the lab for mass production, it was important to construct an allergenicity test. The allergenicity test makes a comparison between the sequences of the biobrick parts and the identified allergen proteins in the database. If the similarity between the biobricks and the proteins is high, it is more likely that the biobrick is allergenic. In the sliding window of 80 amino acid segments, greater than 35% means similarity to allergens. Higher similarity implies that the biobricks have a potential for negative effect to exposed populations. For more information on the protocol see the “Allergenicity Testing Protocol” in the following page http://2017.igem.org/Team:Baltimore_Bio-Crew/Experiments
Our biobrick part, BBa_K2571001 showed less than 35% match in the 80 amino acid alignments by FASTA.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 2008
References
Ask, M., Mapelli, V., Höck, H., Olsson, L., Bettiga, M. (2013) Engineering glutathione biosynthesis of Saccharomyces cerevisiae increases robustness to inhibitors in pretreated lignocellulosic materials. Microbial Cell Factories. 12:87 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3817835/
Burton, G. J., & Jauniaux, E. (2011). Oxidative stress. Best Practice & Research. Clinical Obstetrics & Gynaecology, 25(3), 287–299. http://doi.org/10.1016/j.bpobgyn.2010.10.016
Lu, S. C. (2013). GLUTATHIONE SYNTHESIS. Biochemica et Biophysica Acta, 1830(5), 3143–3153. http://doi.org/10.1016/j.bbagen.2012.09.008
National Center for Biotechnology Information. PubChem Compound Database; CID=124886, https://pubchem.ncbi.nlm.nih.gov/compound/124886 (accessed July 18, 2018). https://pubchem.ncbi.nlm.nih.gov/compound/124886#section=Top
Patrick, L. (2003). Mercury Toxicity and Antioxidants: Part I: Role of Glutathione and alpha-Lipoic Acid in the Treatment of Mercury Toxicity. Alternative medicine review: a journal of clinical therapeutic.(7). 456-471. https://www.researchgate.net/publication/10980025_Mercury_Toxicity_and_Antioxidants_Part_I_Role_of_Glutathione_and_alpha-Lipoic_Acid_in_the_Treatment_of_Mercury_Toxicity
Pizzorno, J. (2014). Glutathione! Integrative Medicine: A Clinician’s Journal, 13(1), 8–12. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/
| None |