Part:BBa_K1592002:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

User Reviews

UNIQ760aef3d0c14f47c-partinfo-00000000-QINU UNIQ760aef3d0c14f47c-partinfo-00000001-QINU //In this part, we would like to realize a point mutation. Totally, this sequence includes 2436bp. So we decided to use PCR to mutate. Mutation site locates at 2238 within BBa_K1592002, C->T.Primer forward is cgaggccgctgctggtgctcacgccactgccggtgccattg,and reverse is caatggcaccggcagtggcgtgagcaccagcagcggcctcg. Mix include: BM2 2 μl, forward primer 2μl, reverse primer 2μl, H2O 19μ, 2×phanta Max Master Mix25μl.Process includes 95°C for 30s, degradation at 95°C for 15s，annealing at 63°C for 15s, extension at 72°C for 2min, 25cycles,72°C for another 5min.Then run a gel to see whether PCR is successful. Use 5k marker and 1% gel running for 30min. After that, extract DNA sample from gel to get final products. But we cannot make sure whether point mutation happened. So we sent sample to a sequencing company. Fortunately, it’s mutated.