Part:BBa_K2629001:Design

The goal of our detector is to reveal the presence one resistance marker of Pseudomonas aeruginosa in a sample after a specific lysis by a bacteriophage. The design of this detector has been inspired by Cork Ireland 2015 team : they created different based on the perfect complementarity of the double strand DNA.
Thus, we - Grenoble team 2018 - decided to create a similar detector of one resistance marker of Pseudomonas aeruginosa pathogen.

1. Bioinformatics Part

1.a. Choice of the target

The detection of bacterial resistance marker will be done by detecting a gene fragment.
<p> Pyo has developed many resistance mechanisms during evolution. The most common mechanisms are multiple mutations leading to AmpC overexpression (ceftazidime), oprD inactivation (meropenem), modification of type II topoisomerases, as well as overexpression of the efflux pump (ciprofloxacin and meropenem) [4].
<p> By doing some reading, we selected the gene that mutated most and looked for common mutations on it. The selected gene was gyrA gene (2772 bp). It encodes for the DNA gyrase subunit A (topoisomerase II) and is on the PA3168 genome PA3168 locus. The gyrase DNA mutation leads to resistance to fluoroquinolones [5] [6]. Fluoroquinolones are antibiotics acting on DNA gyrase, it prevents replication of bacterial DNA and thus bacterial proliferation.
<p>We noticed in several articles explaining the mutations of the gyrA (GenBank: AAG06556.1) gene of Pyo clinical strains, that some were redundant. First, at position 83 of the gyrA gene, threonine becomes an isoleucine (Thr83Ile) [5] [6] [7] [11]. Moreover, in position 87 an aspartate becomes an asparagine (Asp87Asn) [5] [7] [8]. So we decided to work on these two mutations. The advantage is that they are close in the gyrA gene (12 nucleotides between them), this is an important point because the detection target sequence must not exceed 100 nucleotides. Once the location was found, the gene mutated was inserted in NebCutter to see restriction sites.
Finally, a sequence alignment in BLAST was performed to ensure that the fragment was only found in Pyo.
The target is located between nucleotide 229 and nucleotide 721 of GyrA gene.
<p>

Target : antibiotic resistance of biologically selected PAO1 (Red: mutations):

5’ – ACCACCCGCACGGCGACATCGCGGTCTACAACACCATCGTGC – 3'

Design Notes

The probe is designed in order to detect a fragment less than 100 bp. The aim is to create a single strand window that enable the perfect hybridization of our choosen target. It is made by: → Two restrictions enzymes producing cohesives end, SphI and NgoMIV, which goal is to remove the little sequence in between on the bottom strand and thus create a perfect complementarity with the target. But at the end we trust that using PCR linearization could reduce the background of uncut plasmid. → Twi nicking enzymes, Nt.BspQ1 and Nb.BssS1, enzymes that cut one strand of the double DNA strand.

Source

The aim is to detect a small fragment of Pseudomonas aeruginosa DNA. The target was found in GyrA gene (2772 bp) from PAO1 strain (GenBank : AAG06556.1) located in PA3168 locus. The target is located between nucleotide 229 and nucleotide 721. GyrA is found in all Pseudomonas aeruginosa strains and not linked in pathogenic behavior of Pseudomonas aeruginosa.