Part:BBa_K2273112

P_blaR1I Promoter found in Staphylococcus aureus

The promoter P_blaR1I is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].

This part is a composite of the bla operon found in Staphylococcus aureus and constitutes the promoter regulating gene expression of the genes blaR1 and blaI, encoding a beta-lactam receptor and a repressor protein regulating gene expression of the bla operon. If the microorganism is exposed to beta-lactam antibiotics, the receptor blaR1 [1] senses the compound and a signal is transduced into the cytoplasm. Subsequently, the BlaI repressor protein [2] is degraded and frees the P_blaR1I as well as the P_blaZ [3] promoter. Following, the genes blaI, blaR1 and blaZ are transcribed and the beta-lactamase blaZ confers resistance to the antibiotic.

This part features the RFC10 prefix and suffix:

Prefix with	EcoRI, NotI, XbaI	GAATTCGCGGCCGCTTCTAGA
Suffix with	SpeI, NotI and PstI	ACTAGTAGCGGCCGCTGCAGA

Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red)

Beta-Lactam Biosensor

Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor Beta-lactam biosensor] in Bacillus subtilis. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.

Assessing Promoter Activity via Plate Reader

This promoter was evaluated in the context of our [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor beta-lactam biosensor] created in the EncaBcillus project. The results describe the promoter activity of P_blaR1I when the BlaR1I-System was induced with six different beta-lactam antibiotics (ampicillin, carbenicillin, cefoperazone, cefalexin, cefoxitin, penicillin G and two controls (bacitracin, water). The tested concentrations for the plate reader experiments can be extracted from Table 1.

Table 1: Antibiotic concentrations in [µg µl^-1] (final concentration in the well) used in all further plate reader experiments.

The assays were carried out in a 96 well plate format in Mueller Hinton broth and we measured growth (OD₆₀₀) and luminescence output for 18 hours every 5 minutes. Induction with the Beta-lactam antibiotics occurred after 1 hour. All strains have been tested in triplicates under the same conditions. Strains with the genotype penP::kan^R have been induced with lower concentrations compared to the wild type strain W168 (see Table 1 above).
After induction, we anticipate a strong increase in luminescence signal for the strains 1 and 2. For the strains 3 and 4 we expect an increase in luminescence signal in the presence of 0.2% xylose. Xylose will induce the expression of the BlaR1 receptor, therefore enabling sensing of the beta-lactams.
Figure 1 shows the growth of the strains 1 to 4 (genotype defined in the table below the growth curves) for a period of 8hours. In Figure 2 the corresponding luminescence signals are illustrated in RLU/OD₆₀₀. The time point of induction with the antibiotic compounds is indicated by the black line shown at 60 minutes. Standard deviation is depicted as grey error bars.

Figure 1: Growth curves of the potential biosensor strains featuring the P_blaR1I promoter. Black vertical lines at 60 minutes indicate the time point of induction. The legend above the graphs define all tested compounds. The table below describes the genotypes of the tested strains.

Figure 2: RLU/OD₆₀₀ of the potential biosensor strains featuring the P_blaR1I promoter. Black vertical lines at 60 minutes indicate the time point of induction. The legend above the graphs define all tested compounds. The table below describes the genotypes of the tested strains.

For strain 1, we could see a slightly increasing luminescence signal about 500.000 RLU/OD₆₀₀ after induction for ampicillin, carbenicillin, cefoperazone, cefoxitin and penicillin G (see Figure 2). The controls and cefalexin did not seem to cause a distinct increase in signal. Strain 2 is detecting ampicillin, cefoxitin and penicillin G with a comparable output to strain 1 (see Figure 2). Cefoperazone gives the highest luminescence signal with about 2 mio. RLU/OD₆₀₀, while carbenicillin and cefalexin did not induce the promoter. The induced strain 3 behaves similarly to strain 1 as the genotype is the same (see Figure 2). After induction, strain 4 has an expression profile that is comparable to strain 2. Results of the control strains (W168 wildtype and W168 P_veg_lux can be found on the registry entry for the P_blaZ promoter.

Further, we investigated the behaviour of these strains on solid MH-Medium. Therefore we implemented disk diffusion assays using the antibiotic concentrations listed in Table 2.

Table 2: Antibiotic concentrations in [µg µl^-1] used in the disk diffusion assays.

We would expect a bright halo around the inhibition, zones where the cells get in contact with the antibiotic. Instead we could not observe a luminescence signal on solid medium for any of the tested compounds (see Figure 3). This suggests that the signal is too weak on agar plates and therefore can not be detected.

Summary

From these findings we can conclude that there is a slight induction of the P_blaR1I promoter by most of the beta-lactam compounds tested. While cefalexin does not show an induction of the promoter, cefoperazone triggers a strong activation of P_blaR1I. Compared to the other promoter from this study, P_blaZ, the induction of the promoter is weaker for P_blaR1I. Additionally, the strains with the P_blaR1I do not show any detectable signal on solid medium. This indicates, that in the original bla-operon found in S. aureus the expression of the BlaR1I system is weaker than that of the beta-lactamase BlaZ. Therefore, P_blaR1I seems not to be the suitable promoter for the biosensor construct, while P_blaZ showed great functionality. Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]