![](https://parts.igem.org/images/partbypart/icon_composite.png)
Composite
Part:BBa_K2235011:Design
Designed by: Shivashree Dhanaraj and Shanlin Tong Group: iGEM17_Stockholm (2017-10-11)
Sialidase enzyme coding composite N terminally attached to secretion system type 1
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 3178
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 3117
Illegal XhoI site found at 127 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 574
Illegal NgoMIV site found at 649
Illegal NgoMIV site found at 739
Illegal AgeI site found at 2952 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 1119
Illegal SapI site found at 2934
Design Notes
Terminator codon was removed using PCR the following PCR primers in order to fuse the sialidase enzyme composite to the signalling peptide: Fwd: CTAGTCTAGATAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA Rev: CTAGACTAGTTTATTGCTCAGCGGTGGCAGCAGCCAA DNA template: Sialidase composite plasmid (BBa_K2235009).