Part:BBa_K2323002
TEV protease with N-terminal 6x His-Tag under the control of the pT7 promoter
Introduction
TEV protease is a highly specific cysteine protease from the Tobacco Etch Virus. An improvement over BBa_K1319008, the protease can be expressed in strains with T7-polymerase and then purified with the help of the His-TAg for synthetic in-vitro circuits.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 71
Illegal AgeI site found at 803 - 1000COMPATIBLE WITH RFC[1000]
Usage and Biology
The Tobacco Etch Virus (TEV) protease is a cysteine protease with high specificity towards its target sequence. Along with other two proteins in the Tobacco Etch Virus, it has the function to cleave the polyprotein that is produced after translating the whole (+)-stran RNA genome of the virus. In addition, the natural TEV protease contains its own target sequence and thus cleaves itself, reducing its activity over time. For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognises the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. This target sequence is uncommon in natural proteins, allowing the in-vivo expression and use of TEV protease without a toxic side-effect caused by unwanted cleavage of host proteins. To avoid the autolysis, TEV protease is usually used with a single S219V point mutation to make the cleavage site unrecognisable for the protein.
Plasmid composition
As with BBa_K1319008, our plasmid is under the control of a T7 promoter (BBa_I719005 and flanked at the 3' side by a T7 terminator BBa_B0010. In addition to this, purification of the protein is possible thanks to the 6x His-tag at the N-Terminus, right after the promoter.
Cloning, expression and Purification
The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.
| Name | 5'-3' primers sequences |
|---|---|
| p-TEV-His-fwd | catcatcaccatcaccacgccggcggcgaaagc |
| p-TEV-His-rev | catctagtatttctcctctttctctagtatctccc |
After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in E. coli DH5α for plasmid storage and E. coli BL21star for protein expression. For expression, cells were grown in 2xYT medium and then induced with 1 mM IPTG at the exponential phase. 3 h after induction, the protein was purified both via affinity and size exclusion chromatography.
The chromatogram of the protein purification using the Äkta system didn't showed a clear peak, but rather it was distributed along 20 ml of eluat, with a small peak around 24 ml. Although this would suggest impure protein or small yield, 10% SDS-PAGE gels suggests great quantities of TEV protease were purified, specially in fraction #10, which corresponds to the peak seen in the chromatogram. Moreover, even though some contamination with larger proteins was observed, this was more prominent in the first fractions and became smaller as the peak was reached.
- 10% SDS-PAGE of affinity purification of the His-TEV protease
Affinity
Affinity
For an activity test, we incubated 30 µg His-MBP-Cas13a-Lsh as substrate with 1 µg of our TEV protease. We inactivated the cleavage reaction by adding 1x SDS-loading buffer. We analyzed the reaction with a SDS-PAGE and loaded samples, which were incubated 0, 1, 2, 3, 4 ,5 and overnight. The gel shows that nearly all our substrate is already cleaved after 1 h into His-MBP and Cas13a-Lsh.
| None |