Part:BBa_K2342008
DCD1L peptide C terminal linked to a CBM with a 22 AA linker
This part comprises of a Dermcidin derived antimicrobial peptide DCD-1L linked to a Cellulose binding domain (CBM) with a 22 amino acid linker in the C terminal. For the efficient production and purification system, it is combined with a SUMO fusion protein Smt3 and His6x tag. Using this part it is possible to produce the His6x-Smt3-CBM-22 aa linker-DCD-1L in E.coli without killing the host bacteria. This can then be purified using his tag affinity chromatography. Then the His6x-Smt3 tag could be cleaved using the Ulp1 protease enzyme obtaining a free CBM-22 aa linker-DCD-1L protein. The CBM domain helps to immobilize the DCD-1L peptide on a cellulose surface. There are wide range of possible application for this part like cellulose hydrogels for wound care, skin care products, bandages, hospital surface coatings, etc. Instead of Dermcidin, any other antimicrobial peptide could also be added to this system to expand the application range. For further detailed documentation of part usage, function and validation, see following sections below.
Contents:
1. Biology and system
2. Small scale Production
2.1 Cultivations and Induction of protein expression
2.2 Purification
2.3 SDS-Page of protein purification
3 Large Scale Production (Half liter batch)
3.1 Cultivations and Induction
3.2 Cell Lysis and Purification
3.3 SDS-Page of protein purification
4. Concentration process and SDS PAGE
5. Ulp1 enzyme digestion and SDS PAGE
6. MALDI-TOF-TOF Analysis
7. CNF binding essay for CBM proteins
1. Biology and system
Dermcidin is an antimicrobial peptide (AMP) found in primates with no homology to other know AMPs. (2) It is expressed in a constitutive manner in eccrine sweat glands and secreted to epidermal surface as a part of first line of defense. (3) Mature Dermcidin precursor is 110 amino acid long, including signal peptide. Once antimicrobial peptide precursor is secreted with sweat to epidermal surface, 19 amino acid long signal peptide is cleaved, and it goes under further proteolytic processing leading to several Dermcidin derived peptides such as DCD1 and DCD1L. DCD1L is one of the most abundant form of dermcidin derived peptide. DCD1L is a 48 amino acid long anionic peptide active against wide spectrum of bacteria including Staphylococcus aureus, Escherichia coli, and Propionibacterium acnes. (2,6) Although the precise mode of action is not entirely explored, it is thought that DCD1L hexamers form pores on bacterial membrane leading to cell death. (5)
Ulp1 enzyme, known for its robust and specific proteolytic activity against SUMO fusion proteins, is utilized to cleave of 6XHis-Smt3 tag is used for expression and purification. (4) 6xHis tag in N-terminus is used for purification with immobilized metal ion affinity chromatography (IMAC) columns designed for histidine tagged proteins. Employing of Smt3 tag is beneficial in several aspects in our project. Ulp1 enzyme is able to cleavage fusion peptide by recognizing Smt3. Smt3 tag keeps antimicrobial peptide in inactivation form so that the peptide is not toxic to production host, by blocking its adhesion due to relatively large size of His-Smt3 tag. Smt3 tag Another advantage of using Smt3 is due to its effect on solubility and preventing inclusion bodies of fusion peptide significantly easing purification step. Finally, it facilitated easier detection of the peptide with a conventional method, SDS-PAGE.
Also, this part contains cellulose binding domain (CBM3), from Clostridium thermocellum, allowing immobilization of DCD1L on cellulose based materials. Our expression system is inducible with addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to expression culture, since IPTG induces T7 RNA polymerase promoter leading to expression of gene of interest in plasmid.
Promoter information
The pET28a(+) vector contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This promoter can be induced by isopropyl-β-D-thiogalactopyranoside (IPTG) (Novagen pET System)
Once gene of interest is cloned, expression and purification experiments are performed. After it is proven that the system is functioning as intended in small scale expression, large scale expression experiments are performed in order to obtain larger yields of protein of interest.
2. Small scale Production
2.1 Cultivations and Induction of protein expression
For small scale production, 3-4 colonies from the transformation plates were inoculated (the expression strain cells - C2566) transformed with plasmids carrying the gene of interest) in 7 ml LB-kanamycin (50 μg/ml working concentration) and grew the cells at +37 °C until it reached the OD600 value ~0,51. When finished growing the cells, the expression of the gene of interest was induced by adding a final concentration of 0,5 mM IPTG in the cultures and continued to grow at +37 °C shaking.
2.2 Purification
Then, 4h after induction, we pelleted the cells by centrifuging at 12000 x g for 1 minute and discarded the supernatant. Then resuspended the pellet in 100 μl of ThermoFisher Scientific B-PER Bacterial Protein Extraction Reagent, product-78248).
After equilibrating the Qiagen Ni-NTA spin columns with 600 μl of NPI-10 buffer (50 nM NaPi, 300 mM NaCl, pH 8,0) started the protein purification. Loaded the the samples onto the spin columns and centrifuged at 1600 rpm for 5 minutes. Followed by Washing the columns with 600 μl of NPI-20 buffer (50 mM NaPi, 300 mM NaCl, 30 mM imidazole, pH 8,0). Eluted the proteins in 300 μl of NPI-500 buffer (50 mM NaPi, 300 mM NaCl, 250 mM imidazole, pH 8,0). Stored the whole eluate in glycerol (300 μl of eluate + 300 μl of 50 % glycerol). Stored the used spin columns soaked in 0,1 M EDTA solution, at +4 °C. The samples from different flow throughs and elution were then analysed using SDS PAGE.
2.3 SDS-Page of protein purification
SDS-PAGE image (Figure 2) shows that after induction of expression with IPTG, the band gets corresponding to gene of interest gets thicker, from initial (well 1) to 4 hours (well 3). It proves that the T7 promoter system works as intended, without promoter leakage. There are bands in both pellet (well 3) and lysate (well 4) suggesting that protein of interest was partially precipitated. Soluble portion of the protein in lysate is not visible in elution samples in wells 6 and 7, probably due to its low concentration. See large scale production bellow.
3 Large Scale Production (Half liter batch)
3.1 Cultivations and Induction
Large scale protein expression was started by inoculating 3-10 single colonies (of the expression strain cells transformed with plasmids carrying the gene of interest) in 25mL of LB medium with the 50ug/ml Kanamycin and Incubated at +30°C with shaking overnight. The next day we prewarmed 500 mL of LB medium to +37°C in a 2L Erlenmeyer flask and Added 50 ug/ml Kanamycin. Then inoculated 3-5 mL of the overnight grown preculture in 500 mL prewarmed LB. Flask was incubated at +37°C with shaking until OD600 value reached 0.6.
3.2 Cell Lysis and Purification
The 35 ml sample with harvested cells was then lysed using Emulsiflex machine and was injected into the ÄKTA Machine for protein purification using His tag affinity method. During purification, flow-through and elution fractions (Figure 8) were collected on a well plate. Elution fractions were selected with the desired protein from the graph, and ran elution fractions on SDS-PAGE. Fractions that contain the desired protein were pooled, frozen in liquid nitrogen and stored at -20°C.
3.3 SDS-Page of protein purification
After running the selected fractions on the gel, it could be seen that eluates D1, D1, A2, B2, C2, D2, A3, B3, C3 and D3 had our desired protein. Hence these were collected for further protein concentration and buffer exchange step and rest eluates were discarded.
4. Concentration process
After pooling of the eluates it is important to concentrate the peptide samples. The protein was diluted in 20 ml of Buffer B (50 mM NaPi, 300 mM NaCl, 250 mM imidazole, pH 8,0). So the samples were concentrated using Sartorious VIVA SPIN 20 ultrafilter (Membrane: 5000 MWCO PES) and the buffer was exchanged to 10 mM NaPi pH 7.4.
5. Ulp1 enzyme digestion and SDS PAGE
For digesting 6xHis-Smt3-CBM-22Linker-DCD1L with Ulp1 to obtain free CBM-22Linker-DCD1L, 0.5μL of Ulp1 protease was added to 50μL of the purified protein (concentrated in e.g. NaPi buffer). The suitable digestion time was determined by incubating the protein with Ulp1 for different time points and running them on an SDS-PAGE. We can see that 10 mins of Incubation at room temperature is enough.
Undigested samples are highlighted with white boxes: 6xHis-Smt3-CBM-22 aa linker-DCD-1L 37.3kDa. The desired proteins after digestion are highlighted with red boxes: CBM-22 aa linker-DCD-1L 23.8kDa. The digested N-terminus containing the 6xHis-tag and the Smt3-tag (13.5kDa) is highlighted with black.
6. MALDI-TOF-TOF Analysis
The sample after Ulp1 digestion was analysed using mass spec to identify CBM-22 aa linker-DCD-1L. We use matrix-assisted laser desorption/ionization-time of flight/time of flight (MALDI-TOF-TOF) mass spectrometer (UltrafleXtreamTM Bruker, Aalto department of biotechnology and chemical technology facilities, Espoo, Finland) equipped with a 200-Hz smart-beam 1 laser (337 nm, 4 ns pulse) to identify masses of proteins/peptides. Data collection was carried out by operating the instrument in positive ion mode controlled by the flex software packaged (FlexControl, FlexAnalysis). 5,000 laser shots were accumulated per each spectrum in MS modes. Protein Calibration Standard mixture I, II.
7. Cellulose Nano Fiber binding essay for CBM proteins
A straightforward measurement was carried out to see whether the proteins are folded correctly and do indeed bind to cellulose with CBM (Cellulose binding domain), and how well they bind to cellulose. We used 150 ug of CNF and varied the concentration of protein from 0.5 uM to 50 uM. Appropriate amounts of CNF & protein was mixed in an Eppendorf and incubated for 10 min up to an hour at RT. Then the CNF-protein mixture was centrifuged for 10 min at ~4000 g. The supernatant (containing all proteins not binding to CNF) was transferred to a new Eppendorf. The pellet contains the CNF and any proteins sticking to it. The samples were then analysed using SDS-PAGE. SDS-PAGE samples were separated in 12 % gel, fixed with acetic acid/metOH/water mixture and stained with coomassie blue. On gel the samples were put together with prepared samples of the same protein solution without binding to CNF. Any bands that ‘disappeared’ have bound to CNF.
Efficacy of CBM binding of C22D
The efficacy of cellulose binding domain binding to a cellulose substrate is probed. First, the purified protein construct is cleaved with Ulp1 to remove His6x-Smt3 tag, coupled with subsequent heat inactivation of the enzyme. For the binding assay, concentrations of peptide varying from 0.1 µM to 50 µM o in low salt buffer are incubated with 150 µg of cellulose nanoFibrils (CNF). Control samples of matching peptide concentrations are prepared without the addition of CNF. The samples are mixed thoroughly and incubated at room temperature for 1 hour then centrifuged for 10 min at 4000 g. The supernatant from centrifugation is extracted for SDS-PAGE analysis. Prepared SDS-PAGE samples are run in a 12 % acrylamide gel. The gels are fixed and stained with Coomassie blue. For CBM-22 aa linker-DCD-1L a band at 23.8 kDa is expected. The difference in the CBM-22 aa linker-DCD-1L bands between samples containing 150 µg CNF and those with no added CNF corresponds to the amount of protein successfully bound to the cellulose substrate. The SDS-PAGE gels for varying protein concentrations have been presented in Figure 41. The gels containing samples with peptide concentrations below 4 µM have not been presented due to going below the detection limit of Coomassie Blue staining. Based on the SDS-PAGE analysis, we identify that up to a concentration of 10 µM close 100% of C22D appears to successfully bind to the cellulose substrate.
From the images (Figure 7a and 7b) we can observe that our CBM binds to the CNF due to lack of bands in the lanes with CNF. As the concentration of peptides increase, we also observe the protein bands in wells with CNF (Figure 7c). This is because the CNF is saturated with high concentration of protein and there are many unbound proteins in the solution. We calculated approximately that 1 ug of CNF binds 0.49 µg of our protein.
One thing to note here is the presence of the strong band between 15 kDa and 20 kDa which is unidentified. Our initial suspicion regarding the unidentified band was that it corresponds to free CBM based on its molecular weight, since it is 17.4kD. However, this band is also present in wells with CNF meaning that this band can not contain CBM given that CBM bands are not seen due to CNF-CBM binding. Thus we conclude that it is not CBM.
Another possibility is that Ulp1 enzyme cleaves the construct at a position between the 22 linker leaving His6x-Smt3-DCD-1L - with molecular weight 18.3kDa- free from CBM. But we are unclear about it since we haven't observed this in any of our previous experiment gels and it will be further investigated with our modelling studies.
References
1)Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P., & Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data.Bioinformatics, 28(12), 1647-1649.
2)Schittek, B., Hipfel, R., Sauer, B., Bauer, J., Kalbacher, H., Stevanovic, S., Schirle, M., Schroeder, K., Blin, N., Meier, F. and Rassner, G & Rassner, G. (2001). Dermcidin: a novel human antibiotic peptide secreted by sweat glands. Nature immunology, 2(12).
3)Schittek, B. (2012). The multiple facets of dermcidin in cell survival and host defense. Journal of innate immunity, 4(4), 349-360.
4)Malakhov, M. P., Mattern, M. R., Malakhova, O. A., Drinker, M., Weeks, S. D., & Butt, T. R. (2004). SUMO fusions and SUMO-specific protease for efficient expression and purification of proteins. Journal of structural and functional genomics, 5(1), 75-86. 5)Burian, M., & Schittek, B. (2015). The secrets of dermcidin action. International Journal of Medical Microbiology, 305(2), 283-286.
6) Nakano, T., Yoshino, T., Fujimura, T., Arai, S., Mukuno, A., Sato, N., & Katsuoka, K. (2015). Reduced expression of dermcidin, a peptide active against Propionibacterium acnes, in sweat of patients with acne vulgaris. Acta dermato-venereologica, 95(7), 783-786
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 127
Illegal BglII site found at 961 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
| None |