Collections/Best Basic Part
This collection is under curation by iGEM HQ. New parts and information are currently being added to this page.
High-quality basic parts are essential to the Registry. Basic parts are a functional unit of DNA that (usually) cannot be subdivided into smaller component parts. The iGEM community can use these basic parts to create new devices that will be assembled and work predictably.
The following collection contains parts (and teams) that won, or were nominated, for the Best Basic Part award. Generally, these parts:
- are novel and/or provide a useful function
- are highly documented and characterized, with data and visualizations that show they work as expected
- adhere to the iGEM competition's requirements and the Registry's requirements for submissions
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1582001 | sJanus from Trichoderma reesei | Coding | Dongqi Bao | 228 | 1 | . . . cttctgtgccagaccgccgtcggtgcttga |
BBa_K1699001 | Human short TERT promoter | Regulatory | Emil Ruvinov | 378 | . . . ccctccccttcctttccgcggccccgccct | |
BBa_K1893013 | Small transcription activating RNA (STAR) | RNA | Akash Bhattacharjee | 104 | 4 | . . . caaagcccgccgaaaggcgggctttttttt |
BBa_K2033000 | N-dodecanoyl-L-homoserine lactone (C(12)-HSL) Sender- AubI | Signalling | Brady Dennison | 714 | . . . aaattaggcctggtgggcgccgaggcctaa | |
BBa_K2201004 | Nucleotide Transporter PtNTT2 from Phaeodactylum tricornutum | Coding | Christopher M. Whitford | 1728 | 1 | . . . atggaagcgaaaaccaacaaagaaaaataa |
BBa_K2230022 | STM1128/pSB1C3 | Coding | Yi-Lun Huang & Pei-Hong Chen | 1497 | 1 | . . . gaaaaacctgaaccaaaggtgacattatga |
BBa_K2259000 | SynORI framework RNA II - Replication Initiator (Group A) | Project | Laurynas Karpus | 670 | 14 | . . . ttcttcctgttcctggtcttttgctcacat |
BBa_K2668010 | Cerberus : A Molecular Binding Plateform (mSA2-CBM3a-AzF) | Coding | Younes Bouchiba | 1098 | . . . accacgattcctccatcattggacgatccg | |
BBa_K2748000 | U24 protein from human herpesvirus 6A | Coding | Xiaowen Mao | 264 | . . . gttttccatgtgaatcgtcaaaggcgatga | |
BBa_K2753003 | pSB1C3-obGES cds | Coding | WEI KUANGYI | 1704 | 2 | . . . tacgttgacgcgctgttctttacccaataa |
BBa_K2818001 | Cas13d-NLS-ADAR | Coding | Danny Teo Shun Xiang | 4143 | . . . accgagcaggaccagttctcactcacgtaa | |
BBa_K3111011 | DARPin929 | Coding | Matas Deveikis | 477 | 3 | . . . gaggtactccaaaaggccgcaaagctcaat |
BBa_K3187028 | Sortase A7M (Ca2+-independent variant) | Coding | iGEM TU_Darmstadt 2019 | 450 | 2 | . . . atctttgtagctacagaagtcaaactcgag |
BBa_K3264000 | NT-2Rep-CT | Coding | Xinyou Chang | 1041 | . . . caggatagcgtgggtcagtatgtgggctaa | |
BBa_K3352001 | Φ29 DNA Polymerase with His-Tag and GS linker Sequence | Coding | Joyce Ting | 1773 | -1 | . . . ctagtggacgacacctttacgattaaataa |
BBa_K3407004 | Fox-1 RBD: a protein domain binding strongly and specifically to RNA sequence UGCAUGU. | Coding | Javier Navarro Delgado | 363 | -1 | . . . aagacggtgaacccgtacaccaatggctaa |
BBa_K3484000 | Intein-mediated T3(THRB) → sfGFP | Protein_Domain | Andreu Pascuet & Eduard Sune | 2268 | -1 | . . . atcgattacaaagatgacgacgacaaataa |
BBa_K3730035 | Anti-hGPC3-scfv,a single chain variable antibody of human GPC3 protein. In our program, it is fused | Protein_Domain | Linhe Yang | 801 | -1 | . . . ttcggtcagggtactaaactggagatcaag |
BBa_K3758042 | Prrn16, rrn16 promoter (short version) Nicotiana tabacum | Regulatory | Michael Burgis | 64 | -1 | . . . gagggggcagggatggctatatttctggga |
BBa_K4011003 | Fre-SttH | Coding | Peijia Lai | 2307 | -1 | . . . tattttgcggcgatgggccagcgcgtgtaa |
BBa_K4162005 | Hammerhead ribozyme | RNA | Weiwen Chen | 57 | -1 | . . . actgaagagactggacgaaaccaataggtc |
BBa_K4273000 | hSOD-linker-hCatalase | Coding | Xinyue Yao | 2094 | -1 | . . . gcgaacctgcatcatcatcatcatcattaa |
BBa_K4387000 | Nitric Oxide Sensing Promoter pNorVβ | Regulatory | Jana Mehdy, Lea Bruellmann, Marine Mausy | 256 | -1 | . . . caatctgcaattagcaagacatctttttag |