Part:BBa_K1927000:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1927000

These enzymes carry resistance to carbapenems antibiotics. It may also become resistant to other antibiotics as well as this is a quite advanced enzyme. The part is without any promotor for safety reasons as it can become pathogenic if it’s cloned into bacteria. The strains producing this enzyme develop fast and thus are difficult to detect and treat. New and more sensitive diagnostic tools are needed to detect these ESBL producing bacteria. We submitted this part to the iGEM registry in the hope that future teams may use this part to develop other diagnostic tools or antimicrobial compounds towards this enzyme as it’s much needed. It would contribute to improve the antibiotic resistance situation in the world and would be very beneficial for public health.

Generation of biobrick BBa_K1927000
This biobrick’s sequence is collected from a clinical isolate obtained from The National Expertise Center for Antibiotic Resistance in Tromsø. These isolates are collected from different health institutions from all over Norway. This particular gene encodes the enzyme called blaNDM – 1.

Bacteria containing these genes convey resistance to a broad range of β – lactam antibiotics. The sequence was designed with specific flanking regions that would make it suitable for Gibson Assembly into the pSB1C3 shipping vector. We decided we would make this biobrick without any promotor because of the safety concerns that follows a multi - resistant gene.

With some help the flanking regions was designed so it could directly be cloned into the shipping vector without any PCR. We performed PCR on our pSB1C3 part that we retrieved from one of the biobricks in the distribution kit, also with specific designed primers.

Flanking region of gene:

GCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGATG-INSERT-TACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAG

Primers:
V1: tactagtagcggccgctgcagtc 23/64oC/61%
V2: catctagaagcggccgcgaattc 23/62oC/57%
We performed Gibson Assembly (see protocol for details) and transformed the reaction into TOP10 chemically competent cells. The cells were then plated on LB plates containing chloramphenicol.

Figure 1: A few colonies managed to grow on the plates. Confirming the presence of pSB1C3
and also that the assembly was successful. Religation of vector does not happen as frequently
in Gibson Assembly as it does in regular ligation. Even though colonies had grown on the plate we wanted to confirm the presence of our insert. We picked two colonies and performed colony PCR to confirm our insert. We used the primers recommended from iGEM and more details about PCR program you may find under protocols.

Figure 2: We used biobrick BBa_K1189031 as a positive control and empty vector as negative
control. The positive control seemed to be too big in size (bp) for the annealing time used in the program.
Thus it did not give a clear band.
Our biobrick however gives a clear band at around 1000bp which corresponds to the sequence
length, thus the presence of insert is confirmed.

Lane 1: Ladder
Lane 2: Positive control, BBa_K1189031
Lane 3: BBa_K1927002
Lane 4 and 5: J04500 (part only)
Lane 6:empty vector

Figure 3: Displays our biobrick cut with different enzymes.
NotI did not cut that efficient and the gel displays incomplete cutting.
Lane two is our construct cut once, there is a clear band just above 2000bp which
indicates that our construct is successfully linearized and show corresponding base pairs.

Lane 1: 1kb ladder gene ruler
Lane 2: BBa_K1927000 cut once w/XbaI
Lane 3:BBa_K1927000 cut w/ NotI
Lane 4: uncut plasmid.

We did an additional restriction digest with the newly made biobrick BBa_K1927001:

Figure 4: Displays another confirmation that the gene of interest
is within the shipping vector pSB1C3.

Lane 1: 1kb ladder gene ruler
Lane 2: BBa_K1927000 cut w/XbaI and SpeI
Lane 3:BBa_K1927001 cut w/XbaI and SpeI

User Reviews

UNIQ4a10dee0642bda66-partinfo-00000000-QINU UNIQ4a10dee0642bda66-partinfo-00000001-QINU