Part:BBa_K1927000

Usage and Biology

This biobrick contains an ESBL gene called blaNDM-1 E.Coli which represent class B carbapenemase of the ESBL group. It belongs to a rather big group of extended spectrum β - lactamases (ESBL). Bacteria that produces these enzymes are resistant to several types of antibiotics. Classification of ESBL is done in many ways and is rather complicated. Different nomenclatures have been proposed and depated for beta lactamases which includes several hundreds of enzymes.(http://www.lahey.org/studies/webt.asp) Carbapenemase is a versatile group of beta lactamases, they have the abitily to hydrolyze penicillins, cephalosporins, monobactams and cabapenems. For this reason these bacteria can cause serious infections in humans. Carbapenemases are further divided into molecular classes A, B and C. This particular gene belongs to class B which represent metallo-beta-lactamases that contain zink in the active site. The gene has been shown to spread at an unprecedented rate because it has been identified not only in single species but also in unrelated species.

UiOslo’s project will focus on a particular antibiotic resistance mechanism caused by extended - spectrum beta lactamase (ESBL). This is also the reason for generation of this biobrick. These type of enzymes was first detected in 1979 and the prevalence of these ESBL producing bacteria have gradually increased in hospitals and other health care institutions.

The majority of E. Coli ESBL infections are represented by urinary tract infections, but they can also cause other severe infections in the blood stream and the central nervous system. The mechanism for antibiotic resistance is usually the same among different EBSL producing bacteria. It is based on the same principles as other beta lactamases. They have the ability to hydrolyze the beta lactam ring that is the “active site” to several types of antibiotics such as Penicillin derivatives, third - generation cephalosporins and axtreonam. In addition to this, ESBL producing bacteria exhibit co-resistance to many other classes of antibiotics which makes these kinds of infections challenging to treat. Thus, there is need for efficient detection methods and development of better antimicrobal agents among towards these organisms.

Beta lactam antibiotics exhibit the most common treatment for bacterial infections both in Norway and worldwide. Thus, the resistance to beta - lactam antibiotics among gram - negative bacteria is a worldwide problem. At the level of a wider geographic scale, the incidence of ESBL-producing organisms is difficult to resolve due to various reasons, difficulty in detecting ESBL production and inconsistencies in reporting (Steward et al., 2000). Recently, a significant increase in the incidents of ESBL-related infections has been observed throughout the globe (Rupinder et al., 2013, Abhijit et al., 2013, Majda et al., 2013, Meeta et al., 2013, Kritu et al., 2013,Fatemeh et al., 2012 and Gupta, 2007).

In Norway an antibiotic resistance centre in Tromsø generate a comprehensive report each year on the status of antibiotic resistance from all over Norway. First figure displays the prevalence of resistance towards different antimicrobal agents in urinary tract infections in Norway from 2002 to 2014. ESBL numbers here are quite low for now compared to ampicillin, but increases every year.

The precalence of ESBL among E. Coli and K. spp isolates the last couple of years has gradually increased. From 2013 to 2014 the prevalence has doubled and the increase is exponential shows a report generated from National Expertise Center for Antibiotic Resistance. This is why a fast and easy detection method is needed on the market today, so that it may be easier to detect these cases and by detecting them early it will reduce the discomfort of the pasient as well as have a bigger chance of getting rid of the infection before it continues to spread.

Applications of BBa_K1927000

Generation of biobrick BBa_K1927000
This biobrick’s sequence is collected from a clinical isolate obtained from The National Expertise Center for Antibiotic Resistance in Tromsø. These isolates are collected from different health institutions from all over Norway. This particular gene encodes the enzyme called blaNDM – 1.

Bacteria containing these genes convey resistance to a broad range of β – lactam antibiotics. The sequence was designed with specific flanking regions that would make it suitable for Gibson Assembly into the pSB1C3 shipping vector. We decided we would make this biobrick without any promotor because of the safety concerns that follows a multi - resistant gene.

With some help the flanking regions was designed so it could directly be cloned into the shipping vector without any PCR. We performed PCR on our pSB1C3 part that we retrieved from one of the biobricks in the distribution kit, also with specific designed primers.

Flanking region of gene:

GCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGATG-INSERT-TACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAG

Primers:
V1: tactagtagcggccgctgcagtc 23/64oC/61%
V2: catctagaagcggccgcgaattc 23/62oC/57%
We performed Gibson Assembly (see protocol for details) and transformed the reaction into TOP10 chemically competent cells. The cells were then plated on LB plates containing chloramphenicol.

Figure 1: A few colonies managed to grow on the plates. Confirming the presence of pSB1C3
and also that the assembly was successful. Religation of vector does not happen as frequently
in Gibson Assembly as it does in regular ligation. Even though colonies had grown on the plate we wanted to confirm the presence of our insert. We picked two colonies and performed colony PCR to confirm our insert. We used the primers recommended from iGEM and more details about PCR program you may find under protocols.

Figure 2: We used biobrick BBa_K1189031 as a positive control and empty vector as negative
control. The positive control seemed to be too big in size (bp) for the annealing time used in the program.
Thus it did not give a clear band.
Our biobrick however gives a clear band at around 1000bp which corresponds to the sequence
length, thus the presence of insert is confirmed.

Lane 1: Ladder
Lane 2: Positive control, BBa_K1189031
Lane 3: BBa_K1927002
Lane 4 and 5: J04500 (part only)
Lane 6:empty vector

Figure 3: Displays our biobrick cut with different enzymes.
NotI did not cut that efficient and the gel displays incomplete cutting.
Lane two is our construct cut once, there is a clear band just above 2000bp which
indicates that our construct is successfully linearized and show corresponding base pairs.

Lane 1: 1kb ladder gene ruler
Lane 2: BBa_K1927000 cut once w/XbaI
Lane 3:BBa_K1927000 cut w/ NotI
Lane 4: uncut plasmid.

We did an additional restriction digest with the newly made biobrick BBa_K1927001:

Figure 4: Displays another confirmation that the gene of interest
is within the shipping vector pSB1C3.

Lane 1: 1kb ladder gene ruler
Lane 2: BBa_K1927000 cut w/XbaI and SpeI
Lane 3:BBa_K1927001 cut w/XbaI and SpeI