Regulatory
Part:BBa_K2040100:Experience
Designed by: Chilam Poon Group: iGEM16_NYMU-Taipei (2016-10-11)
Revision as of 05:39, 16 October 2016 by Chilam Poon (Talk | contribs)
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K2040100
We used primer 5' ACGTCCTGCAGAATCATGCAGCGCTATGAG 3' 5' ATAAGCGGCCGCCATGATGGTCTAGGGAACG 3' to amplify PMcl1 and XXbp 5' untranslated region downstream the promoter from genomic DNA of Metarhizium anisopliae.
[]
User Reviews
UNIQ42b9067291f14c99-partinfo-00000000-QINU UNIQ42b9067291f14c99-partinfo-00000001-QINU