Part:BBa_K2009820
sfGFP11
Sequence And Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 26
introduction
sfGFP11 length: 48bp
Derived from:synthesis from Sangon
sfGFP11——PSB1C3 is an expression plasmid which insert sfGFP11 into PSB1C3. before sfGFP11, we add a linker(gatggagggtctggtggcggatca) to achieve our goal.SfGFP11 is a part of GFP(from 214bp to 230bp), GFP has been mutated to improve its solubility and self-associating activity. When it express, it will emit green fluorescences lightly under the fluorescence microscope.
We try to find anideal protein tag to be work both invivo and invitro and it can provide a sensitive measurable signal which don’t need external chemical reagents or substrates. Finally we find a way to accomplish this goal—— dividing GFP into sfGFP1-10and sfGFP11. Either the sfGFP1-10 or sfGFP11 will emit green fluorescence slightly under the fluorescence microscope. However, when sfGFP1-10 and sfGFP11 express insame cell, they will interact each other and emit more intense fluorescence than each of them. The split GFP system is simple and does not change fusion protein's solubility.
Usage and biology:The split GFP system has many practical applications. Obtaining soluble, well-folded recombinant proteins for downstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression or refolding conditions.(Ste´phanie Cabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)
Part Sequence
agagaccacatggtccttcatgagtatgtaaatgctgctgggattaca
(All the sequence has been testified by Sangon)
Results:
This is the picture which shows E.coli containing the plasmid of sfGFP11 observed with excitation light.
This is the picture which shows E.coli containing the sfGFP11 plasmid and sfGFP1-10 plasmid observed with and excitation light.
If you want to see all pictures, please go to our notebook.
experimental data:
| sample | OD600 | ABS |
| A10-1 | 2.541 | 8402 |
| A10-2 | 1.486 | 5389 |
| C11-1 | 2.539 | 9939 |
| C11-2 | 2.230 | 8098 |
| A+C-1 | 1.162 | 3078 |
| A+C-2 | 1.077 | 2627 |
The ideal results are the spilt GFP experiment in E-coli to verify the split GFP can function as our expectation, we transform the plamids containing sfGFP1-10 and the plasmids containing sfGFP11 respectively in BL21, cultivating the bacteria at 37°C and shacking at 250 rpm/min overnight. We use fluorescence microscope to observe bacteria under 100X objective lens. From these fluorescent images, we find that fluorescent intensity of sfGFP1-10 is stronger than fluorescent intensity of sfGFP11 and both of them are weak. It corresponds with our expectation that either of separate part of sfGFP have background expression and sfGFP1-10, which is longer, may be brighter after excitation.
However, when the PSB1C3 carrying the part of sfGFP11 and the PSB1A3 carrying the part of sfGFP1-10 ware expressed together in E.Coli, it doesn't present stronger fluorescence intensity than either plasmid is expressed in E.Coli respectively. There are a few reasons can explain it. Firstly, different metabolic stress of two plamids causes indistinct results. PSB1C3 carrying sfGFP11, whose gene length is shorter, may have higher expression level than PSB1A3 carry sfGFP1-10. Secondly, there is obvious fluorescence quenching after excitation. Therefore, results of fluorescent images and fluorescent images appear that co-expression of sfGFP1-10 and sfGFP11 has weaker fluorescence intensity. Thirdly, because sfGFP1-10 and sfGFP11 don’t express in E.Coli at 1:1 ratio, the collision probability may be lower than our expectation.
| None |