Part:BBa_K1795002
E. Coli Codon Optimized fdCAS9 under R0010
This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 1016
Illegal PstI site found at 2642
Illegal PstI site found at 3884 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 1016
Illegal PstI site found at 2642
Illegal PstI site found at 3884 - 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1216
Illegal BglII site found at 1272
Illegal BglII site found at 1414
Illegal BglII site found at 1962
Illegal BglII site found at 3802
Illegal BglII site found at 4041
Illegal BamHI site found at 3604
Illegal BamHI site found at 3965 - 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 1016
Illegal PstI site found at 2642
Illegal PstI site found at 3884 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 1016
Illegal PstI site found at 2642
Illegal PstI site found at 3884
Illegal NgoMIV site found at 4186
Illegal AgeI site found at 3530 - 1000COMPATIBLE WITH RFC[1000]
None |