Regulatory

Part:BBa_K1440066:Experience

Designed by: Xuanye Cao   Group: iGEM14_Fudan   (2014-10-07)
Revision as of 00:57, 29 October 2014 by Eric423627 (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1440066

This is the testing result of part 3. Here we show copGFP knock down data rather than RFP (a kind of RFP on our part3 biobrick), because RFP’s effciency is not good as we think of. We use CMV-RFP plasmid to test the efficiency of RFP, finding that RFP can not even work. so we decide use copGFP instead in Part3.

We use Lipofactine 2000 as the transfection reagent to do transient transfection. We transfect part3 (RFP replaced by copGFP) with tetR plasmid together in the HEK293 cells in 24-well cell dish. After 6 hrs transfection, we dose the each cell plate with certain concentration of doxycycline. And figure (1) shows 36hrs cells’ condition which shows that our part 3 works well.

For this part’s testing, we find [Dox] less then 1ug/ml is sufficient enough to knock down GFP while “control” cell plate show high copGFP transfection efficiency, demonstrating that our transfection efficiency is quite good. And we use blood cell counting chamber to count the GFP positive cell numbers and total cell numbers. We use “GFP positive cell number/ total cell number” to indicate the efficiency of our system. We normolize each tet-on-work cell plate to control cell plate, and draw figure (2) as our final knock down result.

shRNA sequence used: Forward: CCGGGCCGCATGACCAACAAGATGACTCGAGTCATCTTGTTGGTCATGCGGCTTTTT

Reverse:AATTAAAAAGCCGCATGACCAACAAGATGACTCGAGTCATCTTGTTGGTCATGCGGC

Tet on shRNA.jpg
Tet on shRNA data.jpg

User Reviews

UNIQ6347c0800d4d4bee-partinfo-00000000-QINU UNIQ6347c0800d4d4bee-partinfo-00000001-QINU