Part:BBa_K1351024
PcomC, a CSP inducible promoter derived from Streptococcus pneumoniae
CSP-depending promoter PcomC of the two component system ComDE (BBa_K1351015, BBa_K1351016) in Streptococcus pneumoniae (R6). This regulatory site has been shown to be sufficient to drive ComE regulated transcription within S. pneumoniae [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay].
CSP (competence stimulating peptide), a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. BBa_K1351025 is another BioBrick containing comAB promoter of S. pneumoniae with an other CEbs.
ComE dependent promoters containing bases matching (blue) and differing (red) from the CEbs consensus sequence. (figure modified from [http://www.ncbi.nlm.nih.gov/pubmed/23216914 Martin et al. 2013)]
This part was generated with the RFC10 standard and has the following prefix and suffix:
prefix with EcoRI, NotI and XbaI: | GAATTCGCGGCCGCTTCTAGAG |
suffix with SpeI, NotI and PstI: | TACTAGTAGCGGCCGCTGCAG |
Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
First results of this BioBrick are depicted in the following bar chart:
Luminescence of B. subtilis Pxyl - comDE PcomC was measured in MCSE inducing with 0.02 % xylose and different CSP concentrations (0 mg/ml, 100 mg/ml and 1000 mg/ml). This bar chart represents the luminescence output two hours after inducing with CSP. Induction of PcomC with 1000 mg/ml CSP showed a 3 fold increased luminescence output compared with an induction of 0 mg/ml and 100 mg/ml CSP.
In the following graph, a dose response curve of the two CSP inducible promoters PcomC and PcomAB is depicted. The dose response curve was generating using luminescence values two hours after inducing with CSP.
Again, luminescence of B. subtilis Pxyl - comDE PcomC was measured in MCSE inducing with 0.02 % xylose and different CSP concentrations (100 ng/ml, 300ng/ml, 500 ng/ml, 1000 ng/ml, 3000 ng/ml, 5000 ng/ml, 8000 ng/ml and 10000 ng/ml). The activation of PcomC and PcomAB respondes directly on the CSP concentration.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
References
<biblio>
- 1 ComE/ComE~P interplay dictates activation or extinction status of pneumococcal X-state (competence). Martin et al (2012) [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay]
</biblio>
//regulation
None |