Part:BBa_K1431814:Design

amajLime, yellow-green chromoprotein reporter system (Strong Promoter, Strong RBS)

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal NheI site found at 7
  Illegal NheI site found at 30
  
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Design Notes

This Biobrick is constructed through 3 steps:

1. Do double enzyme digestion (XbaI & PstI for BBa_K1033916, SpeI & PstI for BBa_B0034) and do gel extraction, ligation, transformation, picking up single colonies, LB broth incubation, plasmid extraction and gel electrophoresis verification.
2. Do double enzyme digestion (XbaI & PstI for Step 1 product, SpeI & PstI for J23100) and do gel extraction, ligation, transformation, picking up single colonies (can select the positive colonies from the colony color), LB broth incubation, plasmid extraction and gel electrophoresis verification.
3. Do double enzyme digestion (EcoRI-HF & SpeI for Step 2 product, EcoRI-HF & XbaI for B0015) and do gel extraction, ligation, transformation, picking up single colonies (can select the positive colonies from the colony color), LB broth incubation, plasmid extraction and gel electrophoresis verification.
4. Cryopreserved the rest bacteria broth and send samples for sequencing.

Sequencing Result

We sent fresh bacteria broth for sequencing using standard Biobricks sequencing primer VF2/VR. The sequencing cooperation we used is Invitrogen Guangzhou filiale.

Sequence of sequencing primer we used:
VF2: tgccacctgacgtctaagaa
VR: attaccgcctttgagtgagc

The sequencing result was very interesting: compared with the sequence in Parts Registry, three point mutations were observed, one between NcoI and XbaI enzyme recognition site and two in BBa_J23100 sequence. The sequencing result for B0034 was completely inconsistent with the expected sequence. The following figure shows the detailed information.

We observed the similar sequencing result in BBa_K1431814 which is also made up of promoter BBa_J23100. We think this sequencing error may explain the unusual observation when comparing the expression with BBa_J23106 because these two mutations weaken the transcriptional strength of BBa_J23100.

Source

The following list is the Biobricks we've used in construction and their detailed design information.

Part	Type	Discription	Backbone	Location on the plate
BBa_J23100	Promoter	Strong Promoter	BBa_J61002 (Amp)	17D 2014 Kit Plate 4
BBa_J23106	Promoter	Weak Promoter	BBa_J61002 (Amp)	17P 2014 Kit Plate 4
BBa_B0031	RBS	Weak RBS	pSB1A2	1H 2014 Kit Plate 4
BBa_B0034	RBS	Strong RBS	pSB1A2	1N 2014 Kit Plate 4
BBa_B0015	Terminator	Strong terminator (B0010+B0012)	pSB1C3	3F 2014 Kit Plate 3
BBa_K592009	Chromoprotein	amilCP, blue chromoprotein	pSB1C3	19E 2014 Kit Plate 1
BBa_K592011	Chromoprotein	cjBlue, green chromoprotein	pSB1C3	2I 2014 Kit Plate 4
BBa_K1033916	Chromoprotein	amajLime, yellow-green chromoprote	pSB1C3	6M 2014 Kit Plate 4

References

1. Parts Registry Assembly Help
2. Parts Registry Transformation Guideline