Part:BBa_K1431401:Design
One gRNA Sequence for HIV-1
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Method
We used a method derived from the method described in the paper by Feng Zhang[http://www.nature.com/nbt/journal/v31/n9/abs/nbt.2647.html ZhangFgRNA].
Conserved Sequence Analysis
We first extracted all conserved regions from the NIH HIV-1 Reference Genome. In this step, we found around 10 alternatives for the next process. Here all screening processes are done in a per-strain basis because of the high mutability of the HIV-1 virus.
Strip out sequences without PAM
Supplementary Table 1 - Base Percentage of HIV-1 Aligned Genome 730bp-752bp | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
A % | G % | C % | T % | Empty % | Non Empty % | A(Corrected) | G(Corrected) | C(Corrected) | T(Corrected) | |
730 | 0 | 0 | 0 | 56.47 | 43.53 | 56.47 | 0.00% | 0.00% | 0.00% | 100.00% |
731 | 0 | 55.88 | 0 | 0.59 | 43.53 | 56.47 | 0.00% | 98.96% | 0.00% | 1.04% |
732 | 0 | 0 | 0 | 56.47 | 43.53 | 56.47 | 0.00% | 0.00% | 0.00% | 100.00% |
733 | 0 | 54.71 | 0 | 1.18 | 43.53 | 55.89 | 0.00% | 97.89% | 0.00% | 2.11% |
734 | 0 | 0 | 0 | 58.24 | 41.76 | 58.24 | 0.00% | 0.00% | 0.00% | 100.00% |
735 | 56.47 | 0.59 | 0.59 | 0.59 | 41.76 | 58.24 | 96.96% | 1.01% | 1.01% | 1.01% |
736 | 0 | 1.18 | 57.06 | 0 | 41.76 | 58.24 | 0.00% | 2.03% | 97.97% | 0.00% |
737 | 1.18 | 57.06 | 0 | 0.59 | 41.18 | 58.83 | 2.01% | 96.99% | 0.00% | 1.00% |
738 | 60 | 0 | 0 | 0 | 40 | 60 | 100.00% | 0.00% | 0.00% | 0.00% |
739 | 0.59 | 0 | 58.82 | 0 | 40 | 59.41 | 0.99% | 0.00% | 99.01% | 0.00% |
740 | 0 | 0 | 0 | 0 | 100 | 0 | ||||
741 | 0 | 0 | 0 | 0 | 100 | 0 | ||||
742 | 0.59 | 0 | 1.18 | 58.24 | 40 | 60.01 | 0.98% | 0.00% | 1.97% | 97.05% |
743 | 0 | 0 | 60 | 0 | 40 | 60 | 0.00% | 0.00% | 100.00% | 0.00% |
744 | 0 | 1.18 | 58.82 | 0 | 40 | 60 | 0.00% | 1.97% | 98.03% | 0.00% |
745 | 0 | 58.82 | 1.18 | 0 | 40 | 60 | 0.00% | 98.03% | 1.97% | 0.00% |
746 | 0.59 | 0 | 59.41 | 0 | 40 | 60 | 0.98% | 0.00% | 99.02% | 0.00% |
747 | 0.59 | 59.41 | 0 | 0 | 40 | 60 | 0.98% | 99.02% | 0.00% | 0.00% |
748 | 0.59 | 59.41 | 0 | 0 | 40 | 60 | 0.98% | 99.02% | 0.00% | 0.00% |
749 | 0 | 58.82 | 0.59 | 0.59 | 40 | 60 | 0.00% | 98.03% | 0.98% | 0.98% |
750 | 0.59 | 0.59 | 58.24 | 0.59 | 40 | 60.01 | 0.98% | 0.98% | 97.05% | 0.98% |
751 | 60 | 0 | 0 | 0 | 40 | 60 | 100.00% | 0.00% | 0.00% | 0.00% |
752 | 59.41 | 0.59 | 0 | 0 | 40 | 60 | 99.02% | 0.98% | 0.00% | 0.00% |
Select gRNA sequences with the best theoretical quality
HIV-1 Quasi-Conservative gRNAs(Useful) | ||||
---|---|---|---|---|
Sequence | Rating(Zhang) | Rank(Church) | Free Energy(Approx.) | |
GTGTGGAAAATCTCTAGCAGTGG | 71 | - | -1.4 | HIV1_REF_2010 |
TCTAGCAGTGGCGCCCGAACAGG | 97 | - | -1.3 |
Select gRNA sequences with the best theoretical quality
Advantage
Why do we design plasmids that only carry gRNA sequence without Cas9?
One main thought of our project is to achieve the transferring of Cas9 system and gRNA sequences into human body separately at different period of time. As you know, there are two parts in our CRISPER system, one is the Cas9 proteins, and the other is the gRNA. To begin with, Cas9 system will be stably transfected into human cells firstly, remaining inactivated and just waiting for orders. While the transportation of gRNA will not be performed until the diseases have developed, and types of retrovirus that cause these diseases are confirmed. Then, since the type of the pathogenic retrovirus has been known at this moment, we can design a gRNA that can specifically recognize the very type of retrovirus, and transfer it into human body. Finally these gRNA will combine with activated Cas9 proteins, guiding them to the genome sequence of retrovirus, at last destroying it. By this way, we can achieve a more specific introduction of gRNA into human cells, specifically targeting for the very type of retrovirus that caused the disease. The separated transportations of the two parts may also partially overcome the difficulties of radical cure, always met in usual treatment, due to the high variability of retrovirus.
Source
Conserved Region of the HIV-1 Genome from the NIH HIV-1 Sequence Database