![](https://parts.igem.org/images/partbypart/icon_plasmid_backbone.png)
Plasmid_Backbone
Part:BBa_K823055:Design
Designed by: Jara Radeck Group: iGEM12_LMU-Munich (2013-10-16)
pSB1C3F-Vector pSB1C3 with RFP-cassette in Freiburg Standard
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Plasmid lacks a prefix.
Illegal suffix found at 10
Illegal EcoRI site found at 2058
Illegal XbaI site found at 2073 - 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2058
Illegal SpeI site found at 11
Illegal PstI site found at 25
Illegal NotI site found at 18
Illegal NotI site found at 2064 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2058
Illegal XhoI site found at 1042
Illegal XhoI site found at 1934 - 23INCOMPATIBLE WITH RFC[23]Illegal prefix found at 2058
Illegal suffix found at 11 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found at 2058
Illegal XbaI site found at 2073
Illegal NgoMIV site found at 2097 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Design Notes
Two AgeI-restriction sites have been removed by two subsequent quikchange site-directed mutagnesis reactions. The RFP-cassette was PCR-amplified with the overhangs: prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
Source
pSB1C3; the RFP-part is originally from Discosoma sp.