Part:BBa_K1111013:Experience
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K1111013
As said in the main page, this part is a negative control with a lower Kd compared to BBa_K1111012 and BBa_K1111014.
Sequencing
We sequenced this part once the Gibson assembly made. To do so, we used primers for iGEM sites VF2 and VR, in order to sequence all that was inserted in the backbone pSB1C3.
VF2 sequencing results of INP_Streptavidin Dead for two colonies we picked:
File:Team-EPF-Lausanne ClustalW2 VF2 ISD.pdf
VR sequencing results of INP_Streptavidin Dead for two colonies we picked:
File:Team-EPF-Lausanne ClustalW2 VR ISD.pdf
Note: you can notice that there is no overlap between the two sequencing results but thanks to another forward primer (5'- AATAATATGGCCGACCATTG -3') we designed, we were able to confirm the sequences.
Microscopy
Also, we transformed cells and used them to do microscopy. Two experiments were done, one with a fluorescent antibody against streptavidin and the other one with a fluorescent biotin. We did both in case the antibody would be too big, since biotin is a small molecule best suit to cross glycocalix.
User Reviews
UNIQ5d84c35e1911919d-partinfo-00000000-QINU UNIQ5d84c35e1911919d-partinfo-00000001-QINU