Part:BBa_K1139201:Experinece
PphoA-GFP-TT
PphoA is a promoter that is activated by PhoB-phosphorylated when phosphate concentration is low. GFP is a reporter.
1. Introduction To realize our farming project, we improved a phosphate sensor part (BBa_ K1139210, Fig. 1.1) which includes the inducible promoter of the alkaline phosphatase gene (phoA) from E.coli (M. Dollard et al., 2003) because the phosphate sensor part by OUC-China 2012 had insufficient data. The phoA promoter is repressed by high concentration phosphate. A brief system of the phoA promoter is shown in Fig. 1.2. The phoA gene is regulated by phoB and phoR, which belong to pho regulon (H. Shinagawa et al., 1983). Phosphorylated PhoB activates the expression of phoA. Under conditions of phosphate limitation, PhoR phosphorylates PhoB. On the other hand, under conditions of high phosphate concentrations, PhoR dephosphorylate phospho-PhoB (Y. Hsieh et al., 2010). We amplified the phoA promoter from E. coli. (MG1655). We ligated this promoter into GFP part to construct the part and introduced the part into E.coli (MG1655). We assayed induction in response to increase in phosphate concentration to confirm that our part actually works.
Fig. 1.1 Our improved part for phosphate sensing
Fig. 1.2. Mechanism of phoA promoter
2. Materials and Methods 2-1. Construction ※プラスミドの図を入れる -pSB6A1-Ptet-GFP (MG1655)… positive control -pSB6A1-ΔP-GFP (MG1655)… negative control -pSB6A1-PphoA-GFP (MG1655)…BBa_K1139210
The phoA promoter region of E. coli was amplified from MG1655 genomic DNA by PCR using upstream primer (5’-acgtgaattcgcggccgcttctagagaaagttaatcttttcaacagctgtcataaag -3’) and downstream primer (5’-ccgctactagtaaatacattaaaaaataaaaacaaagcgactataagtctc -3’). Amplification was carried out with the steps shown in Fig. 2.
Fig. 2. Steps for PCR of phoA promoter
2-2. Assay Protocol 2-2-0. Prepare MOPS minimal medium as follows (F. Neidhardt et al., 1974). Also, prepare a series of phosphate concentration gradient 1 X MOPS by changing the volume of K2HPO4 (We prepared the series as 0, 10, 30, 100, 300, 1000μM).
[Prepare MOPS minimal medium] 200 mL of 1 X MOPS is prepared as follows.
1. Mix ingredients above and adjust the pH to 7.2 with 5 M NaOH.
2. Filter sterilize. It can be stored at 4 degrees for up to 1 month. 3. Before use, add carbon source (we used a final concentration of 0.1 % glucose).
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 754