![](https://parts.igem.org/images/partbypart/icon_reporter.png)
Part:BBa_K883705
IPTG induced promoter + GFP with a His-tag fused to a coiled coil
GFP with His tag at the C-terminus and the E-coil at the N-terminus behind an IPTG induced promoter to use it as reporter for the E- and K-coil [http://2012.igem.org/Team:Wageningen_UR/Coil_system Plug and Apply system]
Usage and Biology
The E-coil present in this reporter protein is one part of the Plug and Apply (PnA) system consisting of a combination of E- and K-coil. These coils consist of α-helical repeats and have a strong affinity to each other due to electrostatic interactions (with K-coil positively charged and E-coil negatively charged). Using this system one can bind two proteins noncovalently but specifically to each other. This brick can be used for confirmation of the Plug and Apply system using E- and K-coils as well as for detection of proteins that can be fused to the K-coil.
The funcionality of the GFP in the fusion protein was tested and confirmed by observing fluorescence when exposing to UV light.
![](/wiki/images/5/51/Fluorescence_Cbb.png)
Figure 4: BBa_K883705 in DH5α [right; back] exposed to UV light. In the middle: control colony that does not produce fluorescence. On the front/left: BBa_K883704 in DH5α'
![](/wiki/images/f/ff/Fluorescence_bricks_.jpg)
Figure 3: fluorescence GFPcoil + IPTG induced promter in pSB1AK3 in BL21, GFPcoil + His tag + IPTG induced promoter in pSB1AK3 in JM109, BBa_K883704 in DH5α, BBa_K883705 in DH5α measured with fluorescence microscopy. On the right side: before induction (sample taken from liquid medium); on the left side: after induction with IPTG (sample taken from a plate) - of each sample a picture was taken once with light microscopy and once with fluorescence microscopy'
To be able to use the device, the counterpart of the E-coil needs to be fused to the protein that needs to be detected.
name | sequence | translated |
K-coil (counterpart) | aagatagcggcgttgaaggagaaaatcgcagcactaaaagaaaagatagcggcgttgaaggag | KIAALKEKIAALKEKIAALKE |
E-coil (present in the brick) | gaaattgcggcgctggaaaaagaaattgcggcgctggaaaaagaaattgcggcgctggaaaaa | EIAALEKEIAALEKEIAALEK |
Source
The biobrick BBa_I13522 was used as a template for the mutations.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 233
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 233
Illegal NotI site found at 239 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 233
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 233
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 233
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1041
None |