Part:BBa_J45503:Experience
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_J45503
User Reviews
UNIQ874e6d7d6695fb3b-partinfo-00000000-QINU
No review score entered. Username |
The 2005 UCSF iGEM team remarks, "By far, the best promoter is hybB, which controlls the hydrogenase II operon. It is clearly active at temperatures lower than 30oC and is off at temperatures higher than 30oC." |
•••••
[http://2011.igem.org/Team:KULeuven K.U.Leuven iGEM 2011 Team] |
Motivation of this Design/Usage - K.U.Leuven 2011 iGEM Team This part was designed to test the functionality of the promotor region. We cloned the HybB promoter via PCR using the K410000 as a template using the primers below - hyb-FW: CCGGAATTCGCGGCCGCTTCTAGAGCGCCGCTATGGACTGGATAAAG hyb-RV: AAAACTGCAGCGGCCGCTACTAGTATGCTACTTAACCCCATGGTGG Characterization by K.U.Leuven 2011 iGEM Team To test the usefulness of the cold shock-inducible promoter J45503 in our 2011 iGEM project, we fused the promoter to a GFP reporter, and assayed the promoter’s activity after a temperature shift from 37°C to 25°C or 4°C. We tested this activity both in a TOP10F’ (figure 1) as well as a MG1655 (figure 2) E.coli strain background. For more information on E.coli strain descriptions, we recommend the following web site: [http://openwetware.org/wiki/E._coli_genotypes E.Coli_Genotypes]. We can see clearly that transferring cells (both TOP10F’ and MG1655) to lower temperatures (4°C and even 25°C) results in a growth arrest between the 1 and 4 hour time points of our experiment (Figures 1A and 2A). We see that promoter activity is induced when cells are transferred to 25°C and even when they are put in and ice bath (4°C) (Figures 1B and 2B). Unfortunately, however, cells that are kept at 37°C also display an increase in promoter activity, indicating leakiness in the system.
UNIQ874e6d7d6695fb3b-partinfo-00000003-QINU |