Composite

Part:BBa_K358019:Experience

Designed by: Ken Kajita   Group: iGEM10_Kyoto   (2010-10-19)
Revision as of 13:22, 31 October 2010 by Wataru (Talk | contribs) (Experiment1 Characterization of lytic activity with time)

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K358019

Using this part, we checked the function of SRRz gene.

Experiment1 Characterization of lytic activity with time

To characterize the lytic activity of λ lysis cassette in more detail, we focused on when cell lysis occurs after induction of IPTG. We did the experiment as this protocol, and we got the following data Protocol

  1. Pour 3mL of supplemented M9 medium to a Falcon tube.
  2. Pick out a colony on the plate of E.coli and put into the Falcon tube.
  3. Grow it at 30 degreees for 16h.
  4. Dilute it 50 folds with the same media and incubate until OD550 is about 0.15.
  5. Ditribute 3ml of the culture to falcon tubes and add certain amount of IPTG.
  6. Incubate the cultures at 30 degrees and measure OD550 of them every 30 min.
KyotoGrp101028-2.png


As this figure shows, when E.coli starts to lyse depends on the strength of induction of IPTG. When the concentration of IPTG is 1mM, E.coli starts to lyse after 1.5h, in contrast, when it is 0.03mM, E.coli starts to lyse after 6h.



Culture condition:

We also performed some experiences at 37C culture condition. However, in a few experiment, unexpected mutations on lactose promoter had occurred and the promoter wouldn't work in the end. We done the sequencing on this sample.


BBa_R0011: aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca

Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca

To avoid the mutation, we finally decided the cultural temperature at 30C.

User Reviews

UNIQbc0e148a7d237457-partinfo-00000000-QINU UNIQbc0e148a7d237457-partinfo-00000001-QINU