Part:BBa_K371000:Design

Design Notes

In the previous literature，most of research work on pdu BMC(or pdu MCP) focus on Citrobacter Freundii and Salmonella enterica. Taking all of the factors together, we choose Citrobacter Freundii as the orgin of gene in our project. Because the whole genome of Citrobacter Freundii has not been decoded yet, we use the reference sequence sent to NCBI by Martin J.Warren group(GenBank: AM498294.1).By seraching the restriction enzyme site in pduJK(11457-11732), we found a PstI site inside pduJ. And in order to make the part compatible with the RFC53(A noval BioBrick assembly standard designed to facilitate protein fusion) for the following experiment. We also search the EarI, SacI ,SapI and BglII site inside pduJK. There is also a EarI site in pduK.

We got the Citrobacter Freundii from NBRC(NBRC NO.12681). We isolate the whole genome of Citrobacter Freundii. Then we use this genoe as template and mutate the PstI and EarI sites by over lapping PCR. Here is a rough illustration of our mutation workflow.

Six primer used in mutation PCR:

pduJ 1-pduJ 190

f1: 5'-GTTT TCTAGAG CCACAGGAGAAAAGCAGTATGAATAACG-3'

r2:5'-CGCTTGCTGC'''T'''GCGCTTCC-3'

pduJ 190-pduK 318

f3: 5'-GGAAGCGC'''A'''GCAGCAAGCG-3'

r4:5'-GGTCCTCAGGGAT'''T'''TCTTCATGTGGT-3'

pduK 318-pduK 471

f5: 5'-ACCACATGAAGA'''A'''ATCCCTGAGGACC-3' 26

r6:5'-GTTT CTGCAGCGGCCGCTACTAGTA TCACGCTTCACCTCGTTTGCC-3'

In the first step, three different PCR are done with primer f1-r2; f3-r4; f5-r6 separately. Then the product are measured sized and quantity by agarose gel electrophoresis. After extracting the product from gel, same molar number Of three kind of product are mixed together in ddH2O or TE buffer. Then temperature went to 95℃ for 10min, and begin to cool down naturally. The desired pduJK may formed. At the last step PCR, primer 1 and 6 are added to get the last product using annealing products as template.

When we get the sequencing result we found that the sequence results of pduJK were different from the sequence we found on Genebank. Some silent mutation locate in the sequence with no special spacial rule. We suspect that the strain we used is not same with the papar, maybe even belong to different strain of Citrobacter Freundii. However the proterin sequence alignment between the result of Martin J.Warren group, the proterin sequence of pduJK in Salmonella enterica and ours shows that the 'mutation' locate in the nonconserved site. Thus we decide to continue our experement with the gene pduJK.