Part:BBa_K249005
C-terminal Arginine Fusion Vector
pSB1A3 with an C-terminal Arginine tag. This particular plasmid utilizes the BioFusion (aka Silver Lab) Standard for BioBrick assembly. Adds 10 Arginine residues to the C-terminus of a Protein (Includes Stop Codon)
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 23INCOMPATIBLE WITH RFC[23]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 25INCOMPATIBLE WITH RFC[25]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
This part was designed as a plasmid backbone to allow for easy attachment of a C-terminal Arginine TAg to a gene of choice for localization into the lumazine Synthase microcompartment.
This part was shown to work vis the sequencing information that we received.
pSB - C-terminus >lcl|20071
Length=30 Score = 60.0 bits (30), Expect = 1e-15 Identities = 30/30 (100%), Gaps = 0/30 (0%) Strand=Plus/Plus
Query 12 (the plasmid sent in) CGCCGCCGCCGCCGCCGCCGCCGCCGCTAA 41
Sbjct 1 (the sequence expected) CGCCGCCGCCGCCGCCGCCGCCGCCGCTAA 30
We fused a YFP gene with a C-terminal BioFusion standar suffix to this gene
C-terminal EYFP-dT Score = 19.9 bits (10), Expect = 0.80 Identities = 10/10 (100%), Gaps = 0/10 (0%)
Strand=Plus/Plus
Query 659 (the plasmid sent in) GAAGTTCATC 668
Sbjct 135 (the sequence expected) GAAGTTCATC 144
Query 714 ACAGCCACA 722
Sbjct 440 ACAGCCACA 448
The part was sequenced and showed some gaps due to low resolution of the sequencing data. However, it does show that the YFP gene is present, as is the C-terminal Arginine tag. Theses are simply examples of positive hits that came back, although there are many more that are present. In all there were 10 gaps in the sequence, all of which corresponded to N nucleotides in the sequencing information we received.
//proteindomain/localization
tag | Fuses 10Arg tag to any biobrick silver lab fusion standard (C-terminal) |
target | Targets Microcompartments |