Part:BBa_K5119036

pIB184-GFP Shuttle Plasmid Backbone

This plasmid is a low-copy broad host range shuttle plasmid backbone modified from an empty backbone ^[13] to contain a sfGFP dropout for use in Golden Gate Assembly and an RP4 origin of transfer (oriT) for use in conjugation. Through our research, we offer a collection of parts ( BBa_K5119000to BBa_K5119089) that enables researchers to assemble their own plasmid that can replicate in both gram-positive species and E. coli, with the added functionality of secreting enzymes capable of degrading gliadin. Explore the entire collection of parts associated with UT Austin's 2024 iGEM project on the Parts webpage.

Introduction

About 1% of the world population is affected by celiac disease, ^[3] an autoimmune disorder triggered by the ingestion of gluten, a protein commonly found in wheat, barley, and rye.^[4] This immune response can cause significant intestinal damage from chronic inflammation, nutrient malabsorption, and even lactose intolerance, making it crucial to find effective treatments. This is further underscored by the widespread presence of gluten in the human diet. The UT Austin 2024 iGEM team seeks to alleviate the burden of celiac disease by developing a collection of parts capable of secreting proteases in a bacterium specifically designed to degrade gliadin, the primary immunogenic component of gluten.^[5] By engineering this bacterium to break down gliadin in a sustained and localized manner, the team aims to prevent the harmful effects of accidental gluten ingestion, offering a solution to improve the lives of individuals with celiac disease. For more details, please visit our Project Description. Figure 1: The UT-Austin 2024 iGEM parts collection. This collection includes twenty-two constitutive antibiotic resistance promoters & RBS (Type 2), nine secretion tags (Type 3a), two reporter proteins and four reporter proteins & enzymes (Type 3b), a rpoC terminator (Type 4), and three plasmid backbones (Type 56781). Created with Biorender.com.

Our parts collection consists of a diverse array of plasmid backbones (Type 56781), promoters & RBS (Type 2), signal peptides (Type 3a), and enzyme coding sequences (Type 3b), designed to enable the modular engineering of plasmids that express gliadin-degrading enzymes. Drawing from the methodologies established in the Yeast Toolkit^[6] and the Bee Microbiome Toolkit,^[2] our collection allows for the seamless arrangement of genetic parts using type IIS enzymatic Golden Gate Assembly (GGA). Similar to the BTK, our plasmid elements - including broad-host-range promoters, coding sequences, and antibiotic resistance genes - can be independently replaced to optimize performance for specific bacterial hosts. The Ribosome Binding Site (RBS) for all promoters were native to the original antibiotic resistance gene. For all Type 2 parts, the RBS site is included in the individual promoter sequences. Figure 2: An example of an assembly plasmid containing five part types: a plasmid backbone (Type 56781), a promoter (Type 2), a secretion tag (Type 3a), an enzyme coding region (Type 3b), and a terminator (Type 4). Part Type numbers and overhangs are derived from the Yeast Toolkit^[6] and the Bee Microbiome Toolkit^[2] and follow their guidelines. Created with Biorender.com.

Our research focuses on four key areas:

• Shuttle plasmid backbones in gram-positive bacteria
• Weakly constitutive promotors from antibiotic resistance genes
• Gliadin-degrading enzyme expression
• Protein secretion using SecII-dependent signal tags

The parts in our collection work synergistically to achieve varying levels of constitutive production and efficient protein secretion. To investigate this, we created numerous composite parts to identify optimal promoters and secretion tags, focusing on their transcriptional strength and secretion efficiency. These constructs were then inserted into three domesticated backbones, designed to serve as modular plasmid vectors for ideal functionality.

Categorization

Basic parts

• Promoters (Type 2) - 22 broad-host-range promoters were selected from common antibiotic resistance gene cassettes used in engineered plasmids. Each promoter was tested for its relative strengths with a red fluorescent protein in a pIB184 backbone.
• Coding Sequences (Type 3a + 3b)
  • Signal tags (3a) – Nine Sec-dependent signal tags, previously tested in E. coli or derived from gram-positive bacteria, were paired with fluorescent proteins and tested for secretion efficiency. They were further evaluated with gliadin-degrading enzymes.
  • Proteins & Proteases (3b) – Fluorescent proteins such as mScarlet and sfGFP were used as reporters to assess protein secretion. Well-characterized gliadin-degrading enzymes like Kuma030 and AN-PEP were tested for their activity.
• Backbone (Type 56781) – An E. coli expression plasmid and two shuttle vector plasmids with origins that replicate in both E. coli and gram-positive bacteria were modified to create compatible plasmid backbones. They were paired with a green fluorescent protein, signal tags, and gliadin-degrading enzymes.
• Protein secretion using SecII-dependent signal tags

Composite parts

Composite secretion plasmids – These plasmids were created to assess the efficiency of using different tags to secrete reporter proteins or gliadin-degrading enzymes from bacteria.
Composite promoter plasmids – These plasmids were designed to assess the transcriptional strength of the various promoters through fluorescence tests using the iGEM Measurement Kit containing calibration beads for plate readers.

Usage and Biology

pIB184-GFP is a low-copy broad-host-range E. coli to Streptococci shuttle vector plasmid backbone modified from [1]. With both pAMβ1 and ColE1 origins of replication, it is able to replicate in both gram-positive species and E. Coli. It contains an erythromycin resistance gene up to 200 µg/mL. We have modified this backbone to be restriction enzyme compatible in compliance with iGEM assembly standards. We have introduced a type 234 sfGFP dropout from pBTK1093 [2] for use in GGA. An RP4 oriT sequence was also introduced to enable transformation via conjugation. Note that while the sfGFP dropout is present in our backbone, it is omitted in the registry sequence to enable the assembly of composite parts.

Associated Composite Parts

• Amp FL + mScarlet Promoter plasmid – BBa_K5119038 through pBTK1030 + mScarlet + pelB Secretion plasmid – BBa_K5119075. In total, pIB184-GFP is used to make 38 composite parts.

Figure 3: List of Composite promoter plasmids and Composite secretion plasmids. Basic parts of the same type can be interchanged. The table provides definitions for part symbols in SBOL language. Created with Biorender.com.

Part Design and Construction

To domesticate this plasmid to be compatible with iGEM assembly standards and improve its modularity, we had to remove unnecessary restriction enzyme sites and introduce a sfGFP gene and oriT gene. pIB184 had one existing BsmBI site that had to be removed so that it wouldn't interfere with BsmBI GGA reactions. We designed primers to remove this BsmBI site. The primers were designed to contain PaqCI restriction sites in the overhangs. The overhangs were designed to ligate to the plasmid adjacent to the BsmBI site so that when PCR was performed, the BsmBI site would not be amplified. This PCR reaction left the plasmid in two separate PCR products that would be ligated back together later on using GGA.
To introduce a sfGFP gene dropout into pIB184, we designed primers to amplify the sfGFP gene from a pBTK1093 backbone [2]. Primers contained BsaI, BsmBI sites and PaqCI sites for use in GGA. PCR was conducted to create an sfGFP PCR product containing PaqCI overhangs.
To introduce an oriT gene into pIB184, we designed primers to flank an RP4 oriT sequence from a well-annotated CRISPR Associated Transposon (CAST) plasmid from the Barrick Lab. The oriT sequence amplified was:
5'-GTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCC TTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCTCTGATA-3'
We conducted PCR to create a PCR product of this oriT sequence with overhangs containing PaqCI restriction sites for later use in GGA.
We conducted a PaqCI GGA reaction to the two pIB184 PCR products, the sfGFP PCR product, and the oriT PCR product together to create the domesticated pIB184-GFP shuttle plasmid backbone. We then transformed the GGA product into DH5ɑ E. coli, picked a GFP-positive colony, and miniprepped the plasmid DNA. We sequenced confirmed the plasmid using Plasmidsaurus Whole Plasmid Sequencing.

Characterization

It was necessary to test pIB184-GFP’s replicative efficacy in both E. coli and gram-positive species before moving forward with our project. Therefore, transformations into E. coli and various gram-positive species were performed via electroporation and conjugation. Electroporation into five gram-positive species were tested using this shuttle plasmid backbone: Lactococcus lactis ATCC 19435, Lactiplantibacillus plantarum subsp. plantarum ATCC 14917, Lactiplantibacillus plantarum ATCC 10241, Lacticaseibacillus casei ATCC 393, and Rothia mucilaginosa ATCC 25296. Of the gram-positive species, we have only achieved successful electroporation of pIB184-GFP into L. Lactis. We have only achieved successful conjugation of pIB184-GFP from MFDpir E. coli to MG1655 E. coli.

Conjugation

The purpose of introducing an oriT sequence into the shuttle plasmid backbone was to test its ability to be transferred to a bacterium via conjugation. We have tested this plasmid in conjugation experiments using MFDpir E. coli as the donor bacterium and each gram-positive species and MG1655 E. coli as the recipient bacterium. Using species-specific protocols for each species tested, we failed to achieve colony growth on plates selecting for recipient cells containing the antibiotic resistance gene of the plasmid. However, we have achieved successful horizontal transfer of pIB184-GFP from MFDpir E. coli to MG1655 E. coli. Conjugation efficiencies are listed in Table 1.


Table 1: Conjugation efficiencies using MFDpir E. coli as donor and MG1655 E. coli as recipient with pIB184-GFP. "1" and "2" indicate different MFDpir E. coli cultures used and “A” and “B” indicate different replicates using the same culture. CFU/uL calculated using the Barrick Lab Spot Plating Calculator

While conjugation efficiencies were low, the successful conjugation into MG1655 E. colisuggests that the oriT sequence itself is not the cause of failure in conjugation attempts into our gram-positive species.

Electroporation

Across all five gram-positive species, we have only achieved successful electroporation of pIB184-GFP into L. lactis. Selective plates showing L. Lactis transformed with pIB184-GFP are pictured below.


Figure 4: Electroporation of pIB184-GFP into Lactococcus lactis. Grown on CA agar with 20 µg/mL ERY for 72 hours at 30 °C. Plates 1 and 2 were transformed using different minipreps and on different dates.

Transformation efficiencies of these plates were calculated in Table 2. Transformation efficiency formula shown in Figure 5.

Table 2: Transformation efficiency of L. lactis using pIB184-GFP.



Figure 5: Transformation efficiency formula.

Colony PCR was conducted to confirm that our plasmid was present in the transformant colonies. We used primers to PCR-amplify the sfGFP dropout region of the plasmid and ran agarose gel electrophoresis and confirmed the plasmid was present in transformant colonies.

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Plasmid lacks a prefix.
  Plasmid lacks a suffix.
  Illegal EcoRI site found at 363
  Illegal XbaI site found at 367
  Illegal XbaI site found at 5273
  Illegal XbaI site found at 6321
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Plasmid lacks a prefix.
  Plasmid lacks a suffix.
  Illegal EcoRI site found at 363
  Illegal NheI site found at 981
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Plasmid lacks a prefix.
  Plasmid lacks a suffix.
  Illegal EcoRI site found at 363
  Illegal BglII site found at 378
  Illegal BamHI site found at 344
  Illegal XhoI site found at 374
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Plasmid lacks a prefix.
  Plasmid lacks a suffix.
  Illegal EcoRI site found at 363
  Illegal XbaI site found at 367
  Illegal XbaI site found at 5273
  Illegal XbaI site found at 6321
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Plasmid lacks a prefix.
  Plasmid lacks a suffix.
  Illegal EcoRI site found at 363
  Illegal XbaI site found at 367
  Illegal XbaI site found at 5273
  Illegal XbaI site found at 6321
  Illegal NgoMIV site found at 101
  
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Plasmid lacks a prefix.
  Plasmid lacks a suffix.
  

References

1. Novick, R. P., & Murphy, E. (1985). MLS-resistance determinants in Staphylococcus aureus and their molecular evolution. Journal of Antimicrobial Chemotherapy, 16(suppl A), 101–110. https://doi.org/10.1093/jac/16.suppl_a.101
2. Leonard, S. P., Perutka, J., Powell, J. E., Geng, P., Richhart, D. D., Byrom, M., Kar, S., Davies, B. W., Ellington, A. D., Moran, N. A., & Barrick, J. E. (2018). Genetic Engineering of Bee Gut Microbiome Bacteria with a Toolkit for Modular Assembly of Broad-Host-Range Plasmids. ACS synthetic biology, 7(5), 1279–1290. https://doi.org/10.1021/acssynbio.7b00399
3. Lebwohl, B., Sanders, D. S., & Green, P. H. R. (2018). Coeliac disease. Lancet (London, England), 391(10115), 70–81. https://doi.org/10.1016/S0140-6736(17)31796-8
4. Celiac Disease Foundation. (2024). What Is Celiac Disease? Celiac Disease Foundation; Celiac Disease Foundation. https://celiac.org/about-celiac-disease/what-is-celiac-disease/
5. Barone, M.V., Troncone, R., Auricchio, S. Gliadin Peptides as Triggers of the Proliferative and Stress/Innate Immune Response of the Celiac Small Intestinal Mucosa. Int. J. Mol. Sci. 2014, 15, 20518-20537. https://doi.org/10.3390/ijms151120518
6. Lee, M. E., DeLoache, W. C., Cervantes, B., & Dueber, J. E. (2015). A highly characterized yeast toolkit for modular, multipart assembly. ACS Synthetic Biology, 4(9), 975-986. https://doi.org/10.1021/sb500366v
7. LaFleur, T.L., Hossain, A. & Salis, H.M. Automated model-predictive design of synthetic promoters to control transcriptional profiles in bacteria. Nat Commun 13, 5159 (2022). https://doi.org/10.1038/s41467-022-32829-5
8. Engler C., Kandzia R., Marillonnet S. (2008) A One Pot, One Step, Precision Cloning Method with High Throughput Capability. PLOS ONE 3(11): e3647. https://doi.org/10.1371/journal.pone.0003647
9. Potapov, V., Ong, J. L., Kucera, R. B., Langhorst, B. W., Bilotti, K., Pryor, J. M., Cantor, E. J., Canton, B., Knight, T. F., Evans, T. C., & Lohman, G. J. S. (2018). Comprehensive Profiling of Four Base Overhang Ligation Fidelity by T4 DNA Ligase and Application to DNA Assembly. ACS Synthetic Biology, 7(11), 2665–2674. https://doi.org/10.1021/acssynbio.8b00333
10. Sambrook, J., & Russel, D. W. (2001). Molecular cloning a laboratory manual. Cold Spring Harbor Laboratory Press.
11. Baldwin, G., Haddock-Angelli, T., Beal, J., Dwijayanti, A., Storch, M., Farny, N., Telmer, C., Vignoni, A., Tennant, R., & Rutten, P. (2019). Calibration Protocol - Plate Reader Fluorescence Calibration v3. ACS Synthetic Biology. https://doi.org/10.17504/protocols.io.6zrhf56
12. Beal, J., Haddock-Angelli, T., Gershater, M., Sanchania, V., Buckley-Taylor, R., Baldwin, G., Farny, N., Tennant, R., & Rutten, P. (2020). Calibration Protocol - Plate Reader Abs600 (OD) Calibration with Microsphere Particles v4. iGE. https://dx.doi.org/10.17504/protocols.io.bht7j6rn
13. Biswas, I., Jha, J. K., & Fromm, N. (2008). Shuttle expression plasmids for genetic studies in Streptococcus mutans. Microbiology (Reading, England), 154(Pt 8), 2275–2282. https://doi.org/10.1099/mic.0.2008/019265-0
14. Samperio, S., Guzmán-Herrador, D. L., May-Cuz, R., Martín, M. C., Álvarez, M. A., & Llosa, M. (2021, January 22). Conjugative DNA transfer from E. coli to transformation-resistant lactobacilli. Frontiers. https://doi.org/10.3389/fmicb.2021.606629
15. Jennings, M. P., & Beacham, I. R. (1990). Analysis of the Escherichia coli gene encoding L-asparaginase II, ansB, and its regulation by cyclic AMP receptor and FNR proteins. Journal of bacteriology, 172(3), 1491–1498. https://doi.org/10.1128/jb.172.3.1491-1498.1990
16. Ahmadi, Z., Farajnia, S., Farajzadeh, D., Pouladi, N., Pourvatan, N., Karbalaeimahdi, M., Shayegh, F., & Arya, M. (2023). Optimized Signal Peptide for Secretory Expression of Human Recombinant Somatropin in E. coli. Advanced pharmaceutical bulletin, 13(2), 339–349. https://doi.org/10.34172/apb.2023.037
17. Benson, S. A., & Silhavy, T. J. (1983). Information within the mature LamB protein necessary for localization to the outer membrane of E coli K12. Cell, 32(4), 1325–1335. https://doi.org/10.1016/0092-8674(83)90313-6
18. Bowers, C. W., Lau, F., & Silhavy, T. J. (2003). Secretion of LamB-LacZ by the signal recognition particle pathway of Escherichia coli. Journal of bacteriology, 185(19), 5697–5705. https://doi.org/10.1128/JB.185.19.5697-5705.2003
19. Takahara, M., Hibler, D. W., Barr, P. J., Gerlt, J. A., & Inouye, M. (1985). The ompA signal peptide directed secretion of Staphylococcal nuclease A by Escherichia coli. Journal of Biological Chemistry, 260(5), 2670–2674. https://doi.org/10.1016/S0021-9258(18)89413-3
20. Li, Z., Leung, W., Yon, A., Nguyen, J., Perez, V. C., Vu, J., Giang, W., Luong, L. T., Phan, T., Salazar, K. A., Gomez, S. R., Au, C., Xiang, F., Thomas, D. W., Franz, A. H., Lin-Cereghino, J., & Lin-Cereghino, G. P. (2010). Secretion and proteolysis of heterologous proteins fused to the Escherichia coli maltose binding protein in Pichia pastoris. Protein expression and purification, 72(1), 113–124. https://doi.org/10.1016/j.pep.2010.03.004
21. Pechsrichuang, P., Songsiriritthigul, C., Haltrich, D., Roytrakul, S., Namvijtr, P., Bonaparte, N., & Yamabhai, M. (2016). OmpA signal peptide leads to heterogenous secretion of B. subtilis chitosanase enzyme from E. coli expression system. SpringerPlus, 5(1), 1200. https://doi.org/10.1186/s40064-016-2893-y
22. Power, B. E., Ivancic, N., Harley, V. R., Webster, R. G., Kortt, A. A., Irving, R. A., & Hudson, P. J. (1992). High-level temperature-induced synthesis of an antibody VH-domain in Escherichia coli using the PelB secretion signal. Gene, 113(1), 95–99. https://doi.org/10.1016/0378-1119(92)90674-E
23. de Cock, H., Overeem, W., Tommassen, J. (1992). Biogenesis of outer membrane protein PhoE of Escherichia coli: Evidence for multiple SecB-binding sites in the mature portion of the PhoE protein. Journal of Molecular Biology, 224(2), 369-379. https://www.sciencedirect.com/science/article/pii/0022283692910016?pes=vor
24. Adams, H., Scotti, P. A., De Cock, H., Luirink, J., & Tommassen, J. (2002). The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli. European journal of biochemistry, 269(22), 5564–5571. https://doi.org/10.1046/j.1432-1033.2002.03262.x
25. Ravn, P., Arnau, J., Madsen, S. M., Vrang, A., & Israelsen, H. (2000). The development of TnNuc and its use for the isolation of novel secretion signals in Lactococcus lactis. Gene, 242(1-2), 347–356. https://doi.org/10.1016/s0378-1119(99)00530-2
26. Ravn, P., Arnau, J., Madsen, S. M., Vrang, A., & Israelsen, H. (2003). Optimization of signal peptide SP310 for heterologous protein production in Lactococcus lactis. Microbiology (Reading, England), 149(Pt 8), 2193–2201. https://doi.org/10.1099/mic.0.26299-0
27. Morello, E., Bermúdez-Humarán, L. G., Llull, D., Solé, V., Miraglio, N., Langella, P., & Poquet, I. (2008). Lactococcus lactis, an efficient cell factory for recombinant protein production and secretion. Journal of molecular microbiology and biotechnology, 14(1-3), 48–58. https://doi.org/10.1159/000106082
28. Ng, D. T., & Sarkar, C. A. (2013). Engineering signal peptides for enhanced protein secretion from Lactococcus lactis. Applied and environmental microbiology, 79(1), 347–356. https://doi.org/10.1128/AEM.02667-12