Part:BBa_K5317008

MREwt promoter-EGFP

Usage and Biology

The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter gene EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.

The varying Metal Responsive Elements (MREs) upstream of the eukaryotic metallothionein (MT) gene were discovered in the early 80s (Carter et al., 1984; Stuart et al., 1985). All MREs a-d carry core consensus sites (TGCRCNC) to which the primary MRE-binding transcription factor MTF-1 can bind after binding to heavy metal ions and translocating into the nucleus (Wang et al., 2004). Physiologically, this leads to the expression of metallothionein, a protein capable of binding metals such as zinc, cadmium, copper and others for metal homeostasis and detoxification (Cousins 1983). The arrangement of the MREs in our promoter construct was inspired by publications from Glanville et al. (1981) and Searle et al. (1985), maintaining the order of MREs from the physiological murine MT-1 promoter.

Cloning

Theoretical Part Design

Placing the MRE containing promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Cloning

The promoter was synthesized, amplified by PCR with the primers listed in table 1, and inserted by NEB HiFi Assembly into the pEGFP-C2 backbone plasmid (K3338020) after its restriction enzyme digestion with AseI and NheI, generating the MREwt-EGFP cassette.

Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone

Primer name	Sequence
MREwt_fw	CCGCCATGCATTAGTTATGCACACTGGCGCT
MREwt_rev	TGGCGACCGGTAGCGGACGCTTAGAGGACAGC

Figure 1: The vector map of the assembled construct of MREwt inserted into the EGFP-C2 backbone.

Characterization

Transfection experiments in mammalian HEK293T cells assessed the promoter functionality and sensitivity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF-1-mRuby2 carrying plasmid (composite part K5317012) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.

Single-transfection experiments

Figure 2: With the MREwt-EGFP-C2 single-transfected HEK293T cells showed no EGFP signal under unstimulated conditions. Scale bar = 20 µm.

The single transfection with the MREwt-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about sensitivity and specificity of the promoter under homeostatic conditions. In conclusion, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditons.

Co-transfection experiments with MTF-1

Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2-C2 toghether with the MREwt-EGFP-C2 plasmid under homeostatic conditions. The mRuby2 signal from MTF-1 is localized in the nucleus while the EGFP signal is cytoplasmically distributed. Shown are brightfield channels (left), fluorescence channels (images in the center) and an overlay of the channels (right). Scale bar = 20 µm.

CuSO4 stimulation

Figure 4: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2 and the MREwt-EGFP-C2 plasmid before (left column) and after (right column) stimulation with 500 µM CuSO4 for four hours. Scale bar = 20 µm.

FACS analysis

Figure 5: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the MREwt promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. n=1.

References

Carter, A. D., Felber, B. K., Walling, M. J., Jubier, M. F., Schmidt, C. J., & Hamer, D. H. (1984). Duplicated heavy metal control sequences of the mouse metallothionein-I gene. Proceedings of the National Academy of Sciences of the United States of America, 81(23), 7392–7396. https://doi.org/10.1073/pnas.81.23.7392

Cousins R. J. (1983). Metallothionein--aspects related to copper and zinc metabolism. Journal of inherited metabolic disease, 6 Suppl 1, 15–21. https://doi.org/10.1007/BF01811318

Glanville, N., Durnam, D. M., & Palmiter, R. D. (1981). Structure of mouse metallothionein-I gene and its mRNA. Nature, 292(5820), 267–269. https://doi.org/10.1038/292267a0

Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985

Stuart, G. W., Searle, P. F., & Palmiter, R. D. (1985). Identification of multiple metal regulatory elements in mouse metallothionein-I promoter by assaying synthetic sequences. Nature, 317(6040), 828–831. https://doi.org/10.1038/317828a0#

Wang, Y., Lorenzi, I., Georgiev, O., & Schaffner, W. (2004). Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration. Biological chemistry, 385(7), 623–632. https://doi.org/10.1515/BC.2004.077