Part:BBa_K5317021

CMV-ATF2-mRuby2

Usage and Biology

ATF2 belongs to the ATF/CREB family (Kirsch et al., 2020) and its phosphorylation by PknB, making it important for research into signaling pathways related to cell stress and survival, while mRuby2 provides a fluorescent marker for visualisation. In our cell-based & #946;-lactam ring-containing antibiotics sensor, ATF2 serves as a translator of changes in PknB activity at the level of gene regulation, in particular the activity of the ATF2-3xCre2xAP1 promoter.

Cloning

Theoretical Part Design

We placed the mRuby2 fluorescent marker (K5317001) downstream behind ATF2 (K5317015). This gene was codon optimised for human cell lines. This part was amplified by using the primers in table 1.

Table1: Primers used to extract the ATF2 gene sequence.

Primer name	Sequence
ATF2_fw_1	TGAACCGTCAGATCCGatgaaattcaagttacatgtgaattctgccag
ATF2_rv_2	ggatccccacttcctgagggctgtgac
ATF2_fw_3	caggaagtggggatccaccggtcg
ATF2_rv_4	TCAGTTATCTAGATCCGGTGcttgtacagctcgtccatccc

Sequence and features

No part name specified with partinfo tag.