Part:BBa_K5078000
Nos Z gene from P. stutzeri
Promoter and 5' UTR for high level expression in Chlamydomonas reinhardtii
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 541
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 1303
Illegal PstI site found at 541
Illegal NotI site found at 145 - 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1520
Illegal BamHI site found at 467
Illegal XhoI site found at 34
Illegal XhoI site found at 1588 - 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 541
- 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 541
Illegal NgoMIV site found at 1075 - 1000COMPATIBLE WITH RFC[1000]
cacacacctgcccgtctgcctgacaggaagtgaacgcatgtcgagggaggcctcaccaatcgtcacacgagccctcgtcagaaacacgtctccgccacgctctccctctcacggccgaccccgcagcccttttgccctttcctaggccaccgacaggacccaggcgctctcagcatgcctcaacaacccgtactcgtgccagcggtgcccttgtgctggtgatcgcttggaagcgcatgcgatgacgaaggggcggagcaggcggcctggctgttcgaagggctcgccgccagttcgggtgcctttctccacgcgcgcctccacacctaccgatgcgtgaaggcaggcaaatgctcatgtttgcccgaactcggagtccttaaaaagccgcttcttgtcgtcgttccgagacatgttagcagatcgcagtgccacctttcctgacgcgctcggccccatattcggacgcaattgtcatttgtagcacaattggagcaaatctggcgaggcagtaggcttttaagttgcaaggcgagagagcaaagtgggacgcggcgtgattattggtatttacgcgacggcccggcgcgttagcggcccttcccccaggccagggacgattatgtatcaatattgttgcgttcgggcactcgtgcgagggctcctgcgggctggggagggggatctgggaattggaggtacgaccgagatggcttgctcggggggaggtttcctcgccgagcaagccagggttaggtgttgcgctcttgactcgttgtgcattctaggaccccactgctactcacaacaagcc
None |