Part:BBa_K5133006

Microcin H47 generator for CFPS (cell-free protein synthesis)

Group: GEC-China (iGEM 2024, team number: #5133)

Introduction

This composite part is derived from plasmid pJL1 (Addgene: #69496)^[1], consisting of four basic parts: T7 promoter (BBa_K5133000), ribosome binding site (RBS, BBa_K5133001), coding sequence of antimicrobial peptide Microcin H47 (BBa_K5133005), and T7 terminator (BBa_K5133003)(Figures 1, 2). The plasmid pJL1 is commonly used for the in vitro protein expression of cell-free protein synthesis (CFPS)^[2], and the iGEM-standarized CFPS construction has been constructed and characterized yet in our project (BBa_K5133004). To further expand the application of CFPS systems in iGEM competition, this composite part is designed to demonstrate the feasibility of in vitro antimicrobial peptide (AMP) synthesis by CFPS for extended useful purposes.

Figure 1. Schematic design of this part, generated by SnapGene.

Figure 2. Detailed assembly pattern of this composite part, including four basic parts: T7 promoter (BBa_K5133000), RBS (BBa_K5133001), Microcin H47 (BBa_K5133005), and T7 terminator (BBa_K5133003).

Results

For the characterization process of this part, follow five steps showing in Figure 3: (1) molecular cloning; (2) colony PCR; (3) sequencing; (4) plasmid extraction; (5) CFPS reaction.

Figure 3. Workflow for the construction and characterization of this part.

Step 1: molecular cloning

To construct this part, we first need to acquire the linearized DNA fragments of both vector and inserted fragments. Thus, we amplified vector pSB1C3 and inserted fragments by using PCR. Results of agarose gel electrophoresis showing the desired DNA bands (Figure 4) as pSB1C3 (2070 bp) and inserted fragment (511 bp) used in this construction. Note that the PCR template of inserted fragment was derived from the previously reported research article^[2].

Figure 4. Agarose gel electrophoresis analysis of PCR products for molecular cloning. The DNA bands indicate one vector pSB1C3 and three inserted fragments. The second inserted fragment of BBa_K5133006 (511 bp) is used for the construction of this composite part, while the other two inserted fragments are used for BBa_K5133004 and BBa_K5133008, respectively.

When we got the purified DNA products, then we assembled these fragments by using Gibson Assembly strategy^[3]. Next, we transformed the reaction to competent E. coli Mach1-T1 cells and spread the transformants onto LB-agar plates containing 34 µg/mL chloramphenicol. As shown in Figure 5, the E. coli transformants could normally grow on LB-agar plates and be used for the following experiments.

Figure 5. E. coli Mach1-T1 transformants on LB-agar plates, showing the expected phenotype refer to the construction of this part.

Step 2: colony PCR

To verify the constructions, we next performed colony PCR by using the reported protocol^[4]. For each construction (not only this part, but also BBa_K5133004 and BBa_K5133008), we selected four independent colonies from LB-agar plates and used primer pair VF2/VR to amplify the inserted DNA sequences. After that, we analyzed the DNA products by agarose gel electrophoresis. Results show that three PCR products match the desired DNA sizes of this construction, and the other one was the empty vector of pSB1C3 as false positive (Figure 6).

Figure 6. Agarose gel electrophoresis analysis of PCR products for colony PCR. The three DNA products of this construction (BBa_K5133006) match the desired DNA size 782 bp, annotated by green √, while the other one is the empty vector of pSB1C3 as false positive that annotated by red ×.

Step 3: sequencing

Consequently, we picked the desired PCR products for sequencing. Results of Sanger sequencing show the successful construction of this part (Figure 7), which means that the plasmid could be used for the following experiments.

Figure 7. Validation of DNA sequence by Sanger sequencing, generated by SnapGene.

Step 4: plasmid extract

After we acquired the correct plasmids, we then tried to extract and purify the plasmids for the following CFPS reactions. By using the plasmid extract kit, we gained the purified plasmids and analyzed them by agarose gel electrophoresis. Results in Figure 8 show that the extracted plasmids are clean, consisting of two conformations: linear and supercoiled^[5]. To further evaluate the plasmid sizes, we digested the three plasmids by EcoRI (restriction enzyme). After digestion, the three plasmids show the expected linearized comformation and match the desired DNA sizes. These results indicate the successful construction and extraction of this composite part.

Figure 8. Agarose gel electrophoresis analysis of plasmid extracts for three plasmid constructions. The plasmids without EcoRI digestion show two conformations: linear (larger DNA sizes) and supercoiled (smaller DNA sizes), while after EcoRI digestion, the plasmids are linearized and show expected DNA sizes refer to DNA sequences. As for this part, the digested plasmid meet the desired DNA size 2538 bp.

Step 5: CFPS reaction

Once the plasmid was successfully constructed and extracted, we performed the CFPS reactions for demonstrating the feasibility of in vitro AMP Microcin H47 expression (Figure 9).

Figure 9. Schematic diagram of E. coli-based CFPS reaction for AMP Microcin H47 production.

Subsequently, following the commonly used CFPS protocol^[6] and Western-Blot analysis protocol^[2], we successfully produced Microcin H47 (7.4 kDa) with acceptable soluble fraction.(Figure 10).

Figure 10. Western-Blot analysis of E. coli-based CFPS reaction for AMP Microcin H47 production. The in vitro expressed Microcin H47 (c-terminal 6×HisTag, 7.4 kDa) could be detected with a soluble fraction. The plasmid (this construction) was added as 200 ng into 15 µL CFPS reactions, and the other experimental operations followed the reported protocol^[6].

Conclusion

Taken together, this composite part was successfully constructed and characterized, demonstrating the feasibility of CFPS reaction for the in vitro production of antimicrobial peptide Microcin H47. Hence, this CFPS system was further utilized for the in vitro production of another antimicrobial peptide Microcin M (BBa_K5133008) in our project.

DNA sequence (from 5' to 3')

atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatatacat atgcgagaaataacagaatcacagttaagatatatttccggggcgggaggtgcgccagcgacttcagctaatgctgcaggtgctgcagctattgttggagctctcgccggaatacctggtggtccacttggggttgta gttggagccgtatctgccggtttgacaacagcaattggctcgaccgtgggaagtggtagtgccagttcttctgctggtggcggtagccatcatcatcatcatcactaa gtcgaccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaagccaattctga

Red font: T7 promoter (BBa_K5133000)

Green font: RBS (BBa_K5133001)

Blue font: Microcin H47 (BBa_K5133005)

Purple font: T7 terminator (BBa_K5133003)

References

[1] https://www.addgene.org/69496/

[2] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327

[3] Gibson, D.G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6, 343-345 (2009). doi: 10.1038/nmeth.1318

[4] Ba, F. et al. Rainbow screening: Chromoproteins enable visualized molecular cloning. Biotechnology Journal 19, 2400114 (2024). doi: 10.1002/biot.202400114

[5] Lin, C.H. et al. Quantification bias caused by plasmid DNA conformation in quantitative real-time PCR assay. PLoS One 6, e29101 (2011). doi: 10.1371/journal.pone.0029101

[6] Liu, W.Q. et al. Cell-free protein synthesis enables one-pot cascade biotransformation in an aqueous-organic biphasic system. Biotechnology and Bioengineering 117, 4001-4008 (2020). doi: 10.1002/bit.27541

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal XbaI site found at 51
  Illegal PstI site found at 166
  Illegal PstI site found at 175
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal PstI site found at 166
  Illegal PstI site found at 175
  
• 21
  COMPATIBLE WITH RFC[21]
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal XbaI site found at 51
  Illegal PstI site found at 166
  Illegal PstI site found at 175
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal XbaI site found at 51
  Illegal PstI site found at 166
  Illegal PstI site found at 175
  
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Illegal BsaI.rc site found at 32