Part:BBa_K4768006

Split T7 RNA polymerase Cterm conjugated to Trastuzumab with a soluble linker

Part for expression of the split T7 RNA polymerase Cterm conjugated to Trastuzumab with a soluble linker in PURE System

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal XbaI site found at 40
  
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal XbaI site found at 40
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal XbaI site found at 40
  Illegal NgoMIV site found at 1080
  Illegal AgeI site found at 549
  
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Illegal BsaI.rc site found at 21
  

Introduction

Figure 1: Trastuzumab-SL-T7Cterm structure

The CALIPSO part BBa_K4768006 is composed of the anti-HER2 antibody Trastuzumab fused to the C-terminal subunit of the T7 RNA polymerase (residues 181 to 704) through a soluble linker. This gene is under transcriptional control of an SP6 promoter and T7 terminator.

This part, coupled to the part BBa_K4768006 containing the C-terminal subunit of the T7 RNA polymerase, has been designed to develop a split T7 RNAP-based biosensor capable of recognizing HER2, an epidermal growth factor that is overexpressed in cancer cells [1], in solution.

The HER2-induced T7 RNAP complex was designed from two existing constructs: a split T7 RNAP-based biosensor for the detection of rapamycin [2] and a split luciferase conjugated with antibodies capable of recognizing HER2 [3]. We decided to merge the relevant functionalities of these two constructs and created a new biosensor that transduces HER2 binding to gene expression activation.

Figure 2: Recognition of HER2 extracellular domain induces functional assembly of the split T7 RNA polymerase, which enables gene expression of target gene under control of a T7 promoter.

Construction

The CALIPSO part BBa_K4768006 consists in the C-terminal subunit of the T7 RNA polymerase fused to trastuzumab, an anti-HER2 antibody, on its C-terminal domain through an 8-amino-acid linker of glycine and serine residues. The synthesis of this gBlock was made by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.

We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):

Primer T7-F: agttcctcctttcagatttaggtgacactataggggagac

Primer T7-R: gagatctcgatcccgcaaaaaacccctcaagacccg

Figure 3Agarose gel electrophoresis or PCR screening on plasmids extracted from 24 clones.

24 transformants were screened by colony PCR with primers flanking the insertion site within pET21 ( using primers T7-F and T7-R). Unfortunately, no positive transformant was detected (fig. 3).

Conclusion

Due to unsuccessful cloning of this part, we weren't able to progress further with this component and BBa_K4768005 and could not test its functionality. Due to time constraints, we couldn't explore alternative cloning strategies thoroughly. We encourage future iGEM teams to consider different cloning approaches and continue the characterization of the biosensor. Feel free to contact us for additional information!

References

1. Jois et al. 2021. Peptidomimetic Ligand-Functionalized HER2 Targeted Liposome as Nano-Carrier Designed for Doxorubicin Delivery in Cancer Therapy. Pharmaceuticals. 14(3). 221
2. Pu, J., Zinkus-Boltz, J., Dickinson, B. C. 2017. Evolution of a split RNA polymerase as a versatile biosensor platform. Nat Chem Biology 13(4). 432-438.
3. Stains, C. I., Furman, J. L., Porter, J. R., Rajagopal, S., Li, Y., Wyatt, R. T., Ghosh, I. 2010. A General Approach for Receptor and Antibody-Targeted Detection of Native Proteins utilizing Split-Luciferase Reassembly. ACS Chem Biol 5(10). 943-952