Part:BBa_K4768001
dhdO_sfgfp
sfGFP gene under control of a T7 promoter with an operator site known as dhdO for expression in PURE system.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Introduction
The CALIPSO part (BBa_K4768001) is composed of a superfolder gfp gene under the control of DhdR operator site, dhdO. Additionally, the presence of a T7 promoter and terminator allows its expression in PURE system.
This part can be used as a reporter gene to test a biosensor system that relies on the affinity between 2-Hydroxyglutarate (2-HG), an oncometabolite, and DhdR protein. Repression of the sfgfp gene by DhdRis released in the presence of 2-HG. This part is used in our project to validate our biosensor system, which includes the oncometabolite 2-HG, the DhdR protein as a gene repressor, and the dhdO sequence as an operator site.
DhdR is a transcriptional repression factor isolated from the bacteria Achromobacter denitrificans. It is described in the part BBa_K4768000.
Construction
The sfgfp gene was inserted downstream a T7 promoter with an operator site dhdO, described above. The synthesis of the gBlock corresponding to this part was performed by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.
We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):
- T7term-F: AGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCC
- T7term-R: GAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGG
Cloning was successful and two plasmids from positive clones (8) was sent to Eurofins Genomics to check the insert sequence and flanking regions by Sanger sequencing. The correct sequence was obtained with no mutation.
Characterisation
Cell-free production of sfGFP
We used the PCR products of tymp, sfgfp, and anti-HER2 nanobody (anti-HER2-nb) as templates for expression with the PUREfrex2.0 kit (See the protocol here). Additionally, we supplemented the reaction with GreenLys reagent for the co-translational incorporation of fluorescent lysine residues, which facilitated the detection of synthesized proteins by SDS-PAGE.
The presence of the sfGFP protein at the expected molecular weight was visible in lane 4 (Figure 3). This result confirms the successful production of GFP protein in PURE system under non-repressed conditions.
Inhibition of transcription of the sfgfp gene by the DhdR repressor
The aim of the experiments was to establish that the binding of the repressor DhdR to its operator site, dhdO, effectively inhibits transcription of a gene of interest regulated by dhdO. Then, we wanted to show that the presence of 2-HG leads to the de-repression of that gene in PURE system.
Inhibition was tested on the sfgfp reporter gene by fluorescence measurements. To determine the minimal concentration of DhdR required to obtain strong repression, sfGFP was synthesized in the presence of different concentrations of DhdR. The biochemical network model predicted a range of DhdR concentrations expected to lead to different sfGFP levels, which we experimentally tested.
As expected, the higher the concentration of DhdR, the stronger the repression in all three experiments (Figure 5). With the new batch of linear DNA, repression was consistently stronger. We deduced from these results that the optimal concentration of DhdR to efficiently repress expression of a gene under transcriptional control of a dhdO operator sequence was 1.5 µM, validating the predictions of the biochemical network model.
Induction of gene expression that was repressed by 1.5 µM of DhdR was then assayed using physiological concentrations of 2-HG found around tumor cells, i.e., between 10 and 100 µM. A higher concentration was also tested, corresponding to full saturation of the DhdR repressor. The results demonstrate that 2-HG de-represses transcription of DhdR-bound DNA in a concentration-dependent manner (Figure 6). Up to 48% of sfGFP signal was recovered at a saturating concentration of 2-HG. The reason why protein production is not fully restored remains to be investigated.
In-liposome expression of the sfgfp gene
- DhdR repression in liposomes
- Liposomes are capable of expressing GFP in the presence of living cancer cells
Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, either with 1.5 µM of DhdR or without DhdR. Liposomes were imaged by optical microscopy.
Figure 7a displays a population of liposomes localized by the membrane dye Topfluor594. A zoom-in image of liposomes showed the fluorescent rim characteristic of membrane-labeled vesicles (Fig. 7b). The line intensity profile generated with ImageJ confirmed that the intensity was higher at the membrane and lower inside the liposome (Fig. 7c).
Figure 8a displays a population of liposomes expressing the sfGFP gene. In the liposome shown in Fig. 8b, one can clearly see the distribution of GFP fluorescence inside the lumen of the liposome. A quantitative analysis is represented in Fig. 8c. Analysis of the two samples with or without DhdR did not reveal notable differences neither in the occurrence of liposomes exhibiting GFP nor in the intensity level of GFP inside individual liposomes.
Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, Tegafur and 1.5 µM of DhdR. Liposomes were also coated with anti-HER2-nb and folate ligands. Two conditions were tested for exposing liposomes to Caco-2 cancer cells. In the first protocol, liposomes were incubated in a thermocycler for gene expression prior to their functionalization with anti-HER2-nb and injection on top of cancer cells (sample 1). In a second protocol, liposomes pre-coated with anti-HER2-nb were injected in the growth medium on top of Caco-2 cells, where they have been incubated for in situ gene expression (sample 2). The latter protocol more closely mimics the in vivo conditions for drug delivery. Fluorescence microscopy was used to image living cells, liposomes and sfGFP expression.
In sample 1, in the field of view displayed in Figures 9, two liposomes were localized using the fluorescent membrane dye (Fig. 9b) but only one exhibits sfGFP signal (Fig. 9c).
Similar results were obtained with sample 2, as shown in Figures 10.
No difference was observed between liposomes incubated at 37°C and those incubated directly on cancer cells. In both cases, we obtained some liposomes able to produce sfGFP. Follow-up experiments will be necessary to ascertain that gene expression was enabled by 2-HG and not by insufficient repression by DhdR. For instance, optimizing the relative and absolute amounts of DNA and DhdR in liposomes will allow for a better discrimination between repressing and non-repressing conditions.
Conclusion
These experiments provide evidence that this part can be used as a reporter gene to test the 2-HG biosensor. We have also established that this part can be used as a reporter in bulk assays and within liposomes in a tumoral environment containing physiological levels of 2-HG.
References
- [1]Xiao, D., Zhang, W., Guo, W., Liu, Y., Hu, C., Guo, S., Kang, Z., Xu, X., Ma, C., Gao, C., & Xu, P. 2021. A D-2-hydroxyglutarate biosensor based on specific transcriptional regulator DhdR. Nature Communications 12, 7108.
- [2]Jezek, P. 2020. 2-Hydroxyglutarate in Cancer Cells. Antioxid Redox Signal, 33(13),903-926.
| None |