Regulatory
Part:BBa_K4497027
Designed by: Till Gundlach Group: iGEM22_Munich (2022-10-09)
Bidirectional TRE-CMVmin Promoter
ACTAGTTCTAGAGCGGCCGCTGCAGGAATTCCGGGCCGCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAAACGAGCTCTGCTTATATAGGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT
Sequence and Features
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 465
Illegal XbaI site found at 484
Illegal SpeI site found at 490
Illegal PstI site found at 471 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 465
Illegal SpeI site found at 490
Illegal PstI site found at 471
Illegal NotI site found at 476 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 465
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 465
Illegal XbaI site found at 484
Illegal SpeI site found at 490
Illegal PstI site found at 471 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 465
Illegal XbaI site found at 484
Illegal SpeI site found at 490
Illegal PstI site found at 471 - 1000COMPATIBLE WITH RFC[1000]
[edit]
Categories
Parameters
None |